1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sindrei [870]
4 years ago
10

When you are ill with a cold, you fix a bowl of chicken noodle soup to eat to feel better. what factor drives your food choice i

n this situation?​?
Biology
1 answer:
eduard4 years ago
8 0
emotional comfort. according to some studies in psychological science, chicken soup is good for your emotions. the soup plays a great role in reducing the irritation that accompanies common cold. it emotionally and psychologically makes an individual to feel better. in fact individuals are encourage to over eat chicken noodle in the duration they suffer from the common cold.    
You might be interested in
In ____
Artemon [7]

B. A balanced

Explanation:

In a balanced ecosystem decomposers breakdown dead or decaying organisms and they return nutrients to the soil to be used by plants.

A balanced ecosystem maintains an equilibrium between the biotic component and abiotic component of the system.

  • The nutrient cycling between biotic component and abiotic part of the ecosystem is kept going by decomposers.
  • Decomposers are organisms that breaks down dead and decaying organisms.
  • They release the nutrients trapped in them in the process.
  • The nutrient in the soil is in its abiotic state.
  • When plants takes up the nutrient, it enters back into the biotic component.
  • Decomposers helps to maintain the balance in the ecosystem.

Learn more:

Decomposers brainly.com/question/12823338

#learnwithBrainly

8 0
3 years ago
Based on what you’ve seen in the video, why is solving climate change complicated?
spayn [35]

Answer:

The climate system is highly complex, as are the human institutions that are affected by and that must respond to climate change. The difficulty of developing sound strategies for responding to climate change, and of building public support for such strategies, stems in part from the inherent complexity of the issue.Explanation:

4 0
3 years ago
Read 2 more answers
Why don't elephants get cancer?
FinnZ [79.3K]

Answer:

D

Explanation:

Because don't have any p53 genes

8 0
3 years ago
All known organisms use genetic information to produce protein molecules via the same genetic code. This finding strongly suppor
jeyben [28]

Question:All known organisms use genetic information to produce protein molecules via the same genetic code. This finding strongly supports the hypothesis that __________.

a) the earliest macromolecules probably arose when lightning struck an oxygen-free atmosphere

b) all organisms are descended from one or a few common ancestors

c) the genetic code readily evolves by natural selection

d) there's only one possible way to encode information in a macromolecule

Answer:

b) all organisms are descended from one or a few common ancestors

Explanation:

Protein synthesis occurs when the nucleotide sequence of the mRNA is read in the form of genetic codes. A specific genetic code specifies the same amino acid in all living beings. For example, the code "UUU" codes for phenylalanine in all the living beings irrespective of their species. This suggests that all the life forms have originated from one or few common ancestors and the genetic code has been preserved during the course of evolution of various species.

4 0
3 years ago
During what months would you expect most wildfires to occur in florida?
Leokris [45]
I believe it would be  Jan-June months.
During this months, Floride experience its dry period.
Which mean the temperature in that region would be high and it will also had low level humidity. Both of these factors will improve the chance of wildfire from happening.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which type of fungus is shown in the diagram?<br> O club<br> O sac<br> O chytrid<br> O zygote
    5·2 answers
  • Advantages and disadvantages of sky
    5·2 answers
  • Chemicals that we are exposed to that are called carcinogens are a potential cause of A) asthma. B) cancer. C) diabetes. D) hear
    14·1 answer
  • Foods that allow microorganisms to grow are called parasites. TRUE or FALSE
    10·2 answers
  • Among apples, cherries, oranges, and watermelons, a serving of which fruit would raise the level of sugar in blood by the least
    8·2 answers
  • What is the approximate percent of oxygen by volume present in Earth's lower atmosphere?
    6·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • What does the nucleosome<br> do?
    11·1 answer
  • Organisms that have a membrane nucleus belong in which domain?
    5·2 answers
  • Look at the picture<br>​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!