Can someone please help me with this multiple choice question? (biology)

Biology

2 answers:

Alex777 [14]4 years ago

5 0

I and A are the correct responses

Alexus [3.1K]4 years ago

3 0

62. I, there is less d.o. Eutrophication causes dead zones (areas where no fish can survive) in the water because the decomposition of the algae requires oxygen. An example of this can be seen in the Gulf of Mexico.
63. A. tempature. Corals depend on a specific tempature for their survival. The change in tempature is the direct cause of corals going into shock and releasing zooxanthellae. It's actually very sad, many of our reefs have died as a result of climate change.

You might be interested in

5) If a chicken egg were used as a model of a cell,

Natali5045456 [20]

Answer:

A eukaryotic cell, with the yolk representing the nucleus

Explanation:

8 0

4 years ago

What is the material that phases instert into bacteria

Mademuasel [1]

Dk d s s s sixjd dj ndjs. id

6 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Identify the phases of Meiosis II described below.

Annette [7]

1. The lining up of chromosomes by the spindle fibers takes place at metaphase II phase. It is the second stage of meiosis II, the spindle draws the chromosomes towards the metaphase plate.

2. The formation of the nuclear envelope around each set of DNA takes place in telophase II. Along with the formation of the nuclear envelope, the process of cytokinesis also takes place in telophase II, producing four daughter cells, each comprising a haploid set of chromosomes.

3. The sister chromatids are pulled apart in anaphase II stage. In this phase, the sister chromatids are migrated towards the opposite poles of the cell with the help of protein fibers.

4. The centromeres are moved towards the poles of the cell at prophase II stage.

8 0

3 years ago

. Transcribe this DNA strand:<br> AGCTACTAGCAAT

Luba_88 [7]

This is the answer: TCGATGATCGTTA

6 0

3 years ago

Read 2 more answers