Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:the answer should be Different locations of extinct organisms on earth
Explanation:
I believe the correct answer is A) Silurian period occurred before the Neogene era, because the other answer are wrong.
Hadean eon ended before Silurian period.
Mesozoic and Permian era were after Silurian period.
Answer:
Loss of cell plate formation and production of multinuclear monads.
Explanation:
The inhibition of cell-plate formation during cytokinesis will inhibit the development of the phragmoplast which function as a scaffold for cell plate assembly and this will not allow for the formation of a new cell wall needed to separate the two new daughter cells leading to loss of cell plate formation and giving rise to multinuclear monads.
Answer:
The types of volcanoes that I am aware of are dormant, active, and extinct. Active volcanoes are volcanoes that have erupted in the past 10,000 years. Dormant volcanoes are active volcanoes that are supposed to erupt in the future. Extinct volcanoes are volcanoes that have not had an eruption in the last 10,000 years and is not expected to erupt.
