1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BabaBlast [244]
3 years ago
12

All amino acids can be synthesized from intermediates of the:

Biology
1 answer:
larisa [96]3 years ago
6 0

Answer:

A) citric acid cycle alone.

good luck ❤

Explanation:

You might be interested in
Which plays both a role in physical and chemical digestion?
kotykmax [81]

Answer:

Carbohydrate digestion starts in the mouth and protein digestion starts in the stomach.The digestive system fuels the cells and the excretory system rids the body of the cells' waste.

Explanation:

6 0
3 years ago
Read 2 more answers
Which statements describe the inheritance of traits? Select three options.
liraira [26]

Answer:

<u><em>The correct options are:</em></u>

<u><em>All traits are inherited.</em></u>

<u><em>Offspring inherit one allele for a gene from each parent.</em></u>

<u><em>An offspring with two identical alleles for a trait is homozygous.</em></u>

Explanation:

  • In the biological world, a trait can be described as a genetic characteristic which makes up an organism. Every organism has a particular set of traits.

  • Traits are inherited from parents, however they can be influenced by the environment.

  • The alleles of a gene make up the genotype and the influencing phenotype. An organism acquires one allele for the gene pair from each parent.

  • When both the alleles of a gene pair are similar, the organism is said to be homozygous for the trait. If both the alleles of a gene pair are different, the organism is said to be heterozygous for the trait.

3 0
3 years ago
Read 2 more answers
If a compound microscope has a 10x lens in its eyepiece and a 20x lens in its nosepiece ,what is its total magnification?
Arisa [49]
30x Magnification I think hope that helped
6 0
3 years ago
What soil develops on top of there parent bedrock?
maw [93]

Answer:

I think it's top soil.

6 0
3 years ago
Which of the following is false of the integumentary system? A. Too much UV radiation can mutate DNA in skill cells and cause ca
Taya2010 [7]

The statement which is false about the intergumentary system is option D. "Keratin is the pigment responsible for skin color."

Even though the skin color of human beings is affected y different substances, the pigment melanin is responsible for it. Melanin is produced within the skin in cells known as melanocytes and it determines of the skin color of darker-skinned humans.

For instance, the skin color of those who have light skin is determined primary by the bluish-white connective tissue placed beneath the dermis and by the hemoglobin which circulates in the veins of the dermis.

8 0
3 years ago
Read 2 more answers
Other questions:
  • during telophase, cytokinesis has begun how does this differ in onion cells compared to a typical animal cell?
    7·1 answer
  • What occurs during the s phase of interphase
    15·2 answers
  • An allergic reaction that is characterized by the eruption of pale red elevated patches is _____
    6·2 answers
  • Oxygen has an atomic number of 8. The n = 1 energy level has two electrons, and the n = 2 energy level has six electrons. Oxygen
    12·2 answers
  • 2. A cell in the leaf of a green plant performs both photosynthesis and cellular respiration, often at the same time. Which stat
    8·2 answers
  • What is the primary function of the endocrine system
    13·1 answer
  • Select the best answer for the question
    6·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Write a short essay on a local natural resource that is mined in your region and the uses that come from this mineral. List ways
    10·1 answer
  • The diameter of the diagram is 35 mm.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!