1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
14

A single layer of irregularly shaped epithelial cells found lining the respiratory tract is called

Biology
1 answer:
ValentinkaMS [17]3 years ago
7 0
Diptheria. go see your doctor.
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Genotype describes
Inessa05 [86]
I would say characteristics because that's how is organized in the animal kingdom
4 0
3 years ago
1. Name a protein that carries vital materials throughout the body.
mrs_skeptik [129]

Answer:

RBCs contain hemoglobin (pronounced: HEE-muh-glow-bin), a protein that carries oxygen. Blood gets its bright red color when hemoglobin picks up oxygen in the lungs. As the blood travels through the body, the hemoglobin releases oxygen to the different body parts.

Explanation:

Hope this helps.

8 0
2 years ago
Name of the upper limb
Stells [14]

Answer:

I hope this helps u! :D

7 0
2 years ago
Read 2 more answers
In colorectal cancer, some tumor suppressor genes are inactive. This is an important factor resulting in uncontrolled cell divis
tresset_1 [31]

Answer/Explanation:

(1) a mutation in the coding region, resulting in an inactive protein

To check to see if there is a mutation, you could extract the DNA from the cancer cells and then perform PCR to amplify the gene of interest. You could then perform sanger sequencing and compare the sequence to the normal gene to see if a mutation is present. To test the effect of the mutation, you would want to see if an active protein has been formed.

To see if a normal sized protein has been formed, you could perform a western blot, comparing the protein band to the WT protein band. If the protein is absent or much smaller, it is likely not a functional protein.

(2) epigenetic silencing at the promoter of the gene, resulting in reduced transcription.

To check for changes in the epigenetic landscape of the promoter, you could perform chromatin immunoprecipitation by extracting the chromatin from the tumour cells and using antibodies for different chromatin marks to see what has changed between the normal cells and the tumor cells. E.g. H3K9me3, H3K27me3. You would perform a pull down with the antibody of interest and then PCR for your promoter to specifically look at changes at that gene compared to normal cells. To test DNA methylation, you could perform bisulfite sequencing.

To see how transcription is affected, you could extract RNA from the tumor and normal cells, and compare the levels of RNA between the two samples by qRT-PCR

3 0
3 years ago
Other questions:
  • What is the molar mass of Fe(CH2O2)3?
    13·2 answers
  • This type of injury could cause a lose of
    10·1 answer
  • NEED HELP ASAP
    9·1 answer
  • When using data from population genetics research: the sample must be statistically large the sample must be statistically small
    9·1 answer
  • When resources are limited, explain 4 ways by which lizard species on the Bahamas Island can coexist
    5·1 answer
  • What happens is substrate and enzyme is torn
    6·1 answer
  • 10
    13·1 answer
  • Why can an old man not see Clearly​
    12·2 answers
  • Which of the following is part of the Moneran Kingdom?
    14·1 answer
  • Which trait is least likely to be modified by environmental influences? life span height blood type weight
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!