What’s the function of the digestive system

Biology

2 answers:

givi [52]3 years ago

7 0

The function of the digestive system is digestion and absorption.

uranmaximum [27]3 years ago

6 0

Answer:

Explanation:

The function of the digestive system is digestion and absorption. Digestion is the breakdown of food into small molecules, which are then absorbed into the body. The digestive system is divided into two major parts: The digestive tract (alimentary canal) is a continuous tube with two openings: the mouth and the anus.

You might be interested in

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

3 years ago

Scientists observed that when two closely related species of predatory birds live in different areas, they seek prey early in th

vivado [14]

The answer should be A Ecosystem

4 0

4 years ago

Examine this partial food web below for a particular terrestrial ecosystem. species c is toxic to predators. which species in th

Elina [12.6K]