1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
puteri [66]
3 years ago
6

Relative time dating is one way that scientists can understand the relative ages of rocks and fossils. refer to the figure above

. what can you conclude about the relative ages of the labeled rock layers?
A. layer D is older then layer B but younger than layer E

B. layer D is the youngest layer of rock in this figure

C. layer D is the oldest layer of this rock figure

D. layer D is older than layer A bit younger than layer B

Biology
2 answers:
madam [21]3 years ago
8 0

Answer: D

Explanation: Layer D is older than layer A bit younger than layer B.

inysia [295]3 years ago
4 0

Answer: A

Explanation: It looks like A makes the most sense because, it cuts across but still is the median, so you have to put this into perspective when comparing sedimentary rock.

You might be interested in
The carbon atom is sometimes listed as carbon-12 and sometimes as carbon-14 what does this mean? PLZ HELP THIS IS URGENT
nikklg [1K]
Carbon-12 has 6 neutrons and 6 protons, making it 12.
Carbon-14 has 8 neutrons and 6 protons, making it 14.
It is used to date the age of things that are very old using radioactive isotopes.
5 0
4 years ago
What is a difference between starch and glycogen
Anna71 [15]

the structure is the difference between the two


4 0
3 years ago
20.
vekshin1
20. Hoda might not be able to adapt to life in the United States.

25. Am I making the choice, or is fate in control?

29. Hoda might not be able to adapt to life in the United States. [same question as 20.]
5 0
3 years ago
Behavior is produced in living things through the combination of which 2 major influences
Mamont248 [21]

Answer:

abilities, gender, race and culture etc

8 0
3 years ago
According to the current definition of a species, which of the following is an example of a species?
ale4655 [162]

Answer:

Option D.

Example of a species is a donkey and a horse mate to produce a mule that is sterile and is unable to produce babies.

Explanation:

  • Species is the group of organisms that interbreed or have the potential of interbreeding in nature.
  • Even if they look very different in appearance but interbreed then simply they are species.  
  • The organism that reproduce asexually cannot be mentioned under species.
  • Some animals form naturally hybrid and mostly mate with their own groups.
  • So donkey and horse mates to produce a new living, which is considered as the species.

3 0
3 years ago
Other questions:
  • How does weather and climate relate
    11·2 answers
  • Definition: this is one explanation of enzyme specificity that states an enzyme and its substrate possess specific complementary
    6·1 answer
  • Which of the following structures separates the cytoplasm from the environment outside of the cell?
    6·2 answers
  • Which of these of these organisms would most likely be found at the bottom of biomass pyramid?
    8·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • If there are 300 worms in 100m2 of lawn , what is there population density
    14·1 answer
  • 6 main zones of the marine biome
    5·1 answer
  • Use the term “selectively permeable” in a sentence that demonstrates its meaning.
    6·1 answer
  • Why do all plants have similar organelles?
    8·2 answers
  • TRUE or FALSE?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!