1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Genrish500 [490]
3 years ago
10

Why is it important that alhazen begin t test his hypothesis with experiments?

Biology
2 answers:
Hoochie [10]3 years ago
7 0
The experiment is performed in order to either accept or reject the hypothesis based upon the results
slamgirl [31]3 years ago
5 0

Answer:

Accept Or Reject

Explanation:

Personal

Born c. 965 (c. 354 AH)

Basra, Buyid Emirate

Died c. 1040 (c. 430 AH) (aged around 75)

Cairo, Fatimid Caliphate

Religion Islam

Denomination Sunni

Creed Ash'ari

Known for Book of Optics, Doubts Concerning Ptolemy, Alhazen's problem, analysis, Catoptrics, horopter, intromission theory of visual perception, moon illusion, experimental science, scientific methodology,  theory of perception, animal

Muslim leader

Ibn al-Haytham was the first to explain that vision occurs when light reflects from an object and then passes to one's eyes. He was also the first to demonstrate that vision occurs in the brain, rather than in the eyes. Building upon a naturalistic, empirical method pioneered by Aristotle in ancient Greece, Ibn al-Haytham was an early proponent of the concept that a hypothesis must be supported by experiments based on confirmable procedures or mathematical evidence—an early pioneer in the scientific method five centuries before Renaissance scientists.

Born in Basra, he spent most of his productive period in the Fatimid capital of Cairo and earned his living authoring various treatises and tutoring members of the nobilities. Ibn al-Haytham is sometimes given the byname al-Baṣrī after his birthplace, or al-Miṣrī ("of Egypt"). Al-Haytham was dubbed the "Second Ptolemy" by Abu'l-Hasan Bayhaqi and "The Physicist" by John Peckham.Ibn al-Haytham paved the way for the modern science of physical optics.

Contents

Biography

Book of Optics

Theory of optics

Scientific method

Alhazen's problem

Other contributions

Other works on physics

Optical treatises

Celestial physics

Mechanics

Astronomical works

On the Configuration of the World

Doubts Concerning Ptolemy

Model of the Motions of Each of the Seven Planets

Other astronomical works

Mathematical works

Geometry

Number theory

Calculus

Other works

Influence of Melodies on the Souls of Animals

Engineering

Philosophy

Theology

Legacy

Commemorations

List of works

Lost works

See also

Notes

References

Sources

Further reading

Primary

Secondary

External links

You might be interested in
Need people to talk to and maybe a bit of role play but mainly talk
alexandr402 [8]

Answer:

what do you want to talk about?

4 0
3 years ago
Read 2 more answers
What 3 systems get put to work when a beaver is building a home and how?
Lisa [10]

Answer:

beaver dams smooth out water flow by increasing the area wetted by the stream. This allows more water to seep into the ground where its flow is slowed. This water eventually finds its way back to the stream. Rivers with beaver dams in their head waters have lower high water and higher low water levels.

Explanation: Brainlest plz?

6 0
3 years ago
Read 2 more answers
What effect might obesity have on blood pressure? Does obesity alone cause a person to be at risk for high blood pressure? What
Ugo [173]

Answer:

obesity increases blood pressure

Explanation:

This is because the high fat percentage in the body has lead to a build up of fat on the inside of arteries and this makes them thinner. the heart has to pump harder to get the blood around the body and through these, now smaller arteries. therefore yes having diabetes does increase blood pressure.

other factors which increase blood pressure are high stress levels, smoking, anxiety.

6 0
2 years ago
On microscopic examination, John observed yeast cells dividing into daughter cells. What type of asexual reproduction does this
KATRIN_1 [288]
 The type of asexual reproduction  which is being represented is definitely C. Fission, because according to the data above the entity has divided into two or more parts which is a characteristics for the fission.
8 0
3 years ago
How does the density of fresh water compare to the density of salt water
Talja [164]
The density of salt water is greater than the density of fresh water
4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What are two ways does a deer depends on a plant
    7·2 answers
  • Which elements make up molecules of sugar
    8·2 answers
  • What is the biological species concept?
    15·1 answer
  • What section of the kidney collects the urine??
    9·1 answer
  • Which of the following is a product of cellular respiration?
    11·1 answer
  • A water molecule is composed of two hydrogen atoms and one oxygen atom arranged in a bent shape since oxygen is significantly mo
    14·1 answer
  • If shelter wood cutting occurs regularly in a large forest, what would be the result after five years?
    7·1 answer
  • Which structure is unique to eukaryotic cells
    5·1 answer
  • Most energy conversion processes are not efficient.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!