1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jet001 [13]
3 years ago
13

Which plates border the indo Australian plate

Biology
2 answers:
7nadin3 [17]3 years ago
6 0

Answer:

My answer:

Explanation:

the plates which borders the indo Australian plate can only be

1) Pacific

2) African

3) Eurasian

Xelga [282]3 years ago
3 0
Pacific, Africa, Eurasian .
You might be interested in
Reproductive isolation is not an accurate term to describe populations of a species that
Ainat [17]
Your answer is D lives in the same region as others closely related species. Because it wouldn't be C cause that's not isolation it would be B cause there not plants and its not A because it is reproductive but its not isolation.
6 0
3 years ago
A geologist uses relative dating methods to guess that a rock is between 1 million and 5 million years old. What is one radioact
vovangra [49]

Answer:

Scientists usually use the potassium-argon method to date rocks that are older than about 1 million years. Uranium-238 is also used for radiometric dating. It has a half-life of 4.5 billion years. It decays to produce lead-206.

5 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What is a "True Mineral"?
Tatiana [17]

Answer: Minerals range in composition from pure elements and simple salts to very complex silicates with thousands of known forms. The study of minerals is called mineralogy. To be classified as a "true" mineral, a substance must be a solid and have a crystal structure.

7 0
3 years ago
WHY is this football player wearing an oxygen mask? what is the importance of oxygen here? What is he trying to avoid by wearing
shusha [124]

Answer:

bc oxygen contributes to muscle performance on and off the field.

3 0
3 years ago
Other questions:
  • A ribosome builds a chain of amino acids in the proper sequence <br> a. True <br> b. False
    7·1 answer
  • What properties do alcohol and water share?
    8·1 answer
  • Based on the cycle of photosynthesis and cellular respiration, one can say that the ultimate original source of energy for all l
    8·1 answer
  • The condition caused by a parasite living off another organism:
    10·1 answer
  • Starlings produce an average of five eggs in each clutch. if there are more than five, the parents cannot adequately feed the yo
    15·1 answer
  • How do the Linnaean scientific names compare to the names developed by John Ray?
    12·1 answer
  • Based on the data on this map where is most of earths water vapor?
    6·1 answer
  • What is the difference between a coefficient and a subscript
    5·2 answers
  • A tide is
    12·1 answer
  • Explain a chromosome deletion and the effect it can have on a human.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!