1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
12

PLEASE HELP!!!!100 POINTS WILL MARK BRAINLIEST

Biology
2 answers:
Juli2301 [7.4K]3 years ago
7 0
It should be an igneous rock because it formed by the volcanoes lava cooling down
NISA [10]3 years ago
7 0

Answer:

Explanation:

The letter is E

You might be interested in
AN ORGANISM reaction to a change in its surrounding is called
VladimirAG [237]
An adaptation-----------------------
5 0
3 years ago
Which surface exhibits the highest albedo measurement?
Lelu [443]
Albedo is the "whiteness" of a surface. It is a reflection coefficient, and has a value of less than one. The albedo of a surface is the ratio of radiation reflected from the surface to the incident radiation. Hope this helps. Have a nice day. Feel free to ask more questions.
3 0
3 years ago
Which organism is an example of an organism that is an active filter feeder?
Reika [66]

d. Sea Cucumber

Sea cucumbers are filter feeder. Sea cucumbers often find places that have strong currents to find food.

7 0
3 years ago
Read 2 more answers
What are five changes to the planet that are most likely to happen because of the change in global climate?
dem82 [27]

Answer:

increase of greenhouse gases

increased temperature

melting of polar iced caps

raised sea levels

frost free/ growing season will lengthen

more drought and heat waves

increased intensity of hurricanes

heres more-

https://climate.nasa.gov/effects/

8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • A eukaryotic cell has:
    7·1 answer
  • Describe the steps of hemostasis.
    13·2 answers
  • Which object is a gaseous giant?
    13·2 answers
  • The pigmented portion of the eye that has a rounded opening through which light passes is the ________.
    9·2 answers
  • Victoria is comparing laundry detergents. She set up an experiment to determine which detergent will be the most effective in re
    7·1 answer
  • Which animals have had the bovine growth hormone injected into them in order to produce larger individuals?
    6·1 answer
  • 9. Scientists have been studying a forest for the past 20 years and have determined the ecosystem to be
    8·1 answer
  • Why do scientists use Punnett squares?
    7·2 answers
  • Please helpppppp will give brainliest
    10·1 answer
  • What is a reservoir fit carbon and nitrogen, but not phosphorus?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!