1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
4 years ago
10

What would happen if the concentration of h+ ions were the same on both sides of the membrane when the channel opened?

Biology
2 answers:
vaieri [72.5K]4 years ago
8 0
H+ ions would not flow

GalinKa [24]4 years ago
7 0

Diffusion happens against a concentration gradient. Diffusion of a particles occurs when it moves from a region of higher concentration to region on lower concentration. Diffusion occurs as long as there is a difference in concentration. Diffusion stops as soon as there is no concentration gradient.  

There is no diffusion of  H⁺ ions when the channel opens as the concentration of H⁺ ions are the same on both sides of the membrane.

You might be interested in
1.
SSSSS [86.1K]
1-The correct answers is C- evolutionary classification.
Evolutionary classification/taxonomy is a branch of biological classification. The objective is to classify organisms and group them based on their shared descent, progenitor-descendant relationship and degree of evolutionary change. Now this classification can be done by comparing DNA sequences of the organisms and seeing how many they have in common

2- The correct answer is A-cladistic analysis.
A cladistic analysis is focused on categorizing the organisms based on their derived characters. And what is that? that means they are getting categorized
according to their evolutionary relationships( from ancestral characters).
So, species are going to be classified according to how recent their common ancestor is. If two species have a more recent ancestor they will end up in the same group
If the common ancestor between them is far, the distance between the respective taxa will be bigger.

3- The correct answers is C.
A derived character is a characteristic that appeared throughout evolution, still remains in a lot of different taxonomic groups and allows us to identify those groups.
From the options given, C is the only correct one because the presence of hair (a derived character)  only exists in mammals( the group). Other animals don't share that trait.


4-The answer is A.
In each node, a taxon was only one but then was divided into two taxa. Therefore, each node will represent a common ancestor of the taxon.
The correct option is A because the last node or terminal node is the hypothetical last common ancestor of the taxon on the cladogram.

5-  The correct answer is A.-DNA can solve evolutionary puzzles.
Dna has been helping understand how an organism is similar to more than one species, and that way, we can classify the organism the best way possible.
This can be achieved by comparing the nucleotides of the organism we want to classify, with other species. There are databases that have all the DNA sequenced so, what's left to do is count the common nucleotides and their positions.
3 0
3 years ago
Which is a disadvantage of asexual reproduction?​
Nitella [24]
The animal can only regenerate its own genes
4 0
3 years ago
Read 2 more answers
Hydra reproduce by growing their offspring on their bodies and then detaching them once mature enough. This form of asexual repr
Alisiya [41]

Answer:

Budding

Explanation:

Budding occurs when the parent organism develops a bubble like bud which can ultimately become a new individual after maturity.

3 0
3 years ago
When a behavior is followed by negative reinforcement, the behavior is likely to
AnnZ [28]
The answer is D it will increase
8 0
3 years ago
Which step of respiration produces the most energy for the organism?
antiseptic1488 [7]

Answer:

krebs cycle produces the most energy for the organism

4 0
4 years ago
Read 2 more answers
Other questions:
  • Which is the correct statement about gametogenesis
    6·1 answer
  • The newborn's brain is about 25 percent of its adult weight by birth; by the second birthday, the brain is about ________ percen
    13·1 answer
  • The law of segregation states that allele pairs separate during gamete formation. How then do we have two alleles for a trait?
    10·1 answer
  • How does new discoveries helped us to redefine the classification of organisms?
    11·1 answer
  • Why pollen is important in fertilization?
    13·1 answer
  • In any food web, the organisms that are responsible for converting raw energy into usable chemical energy are collectively calle
    10·1 answer
  • What type of muscle is found in the leg
    6·1 answer
  • Как понять последнее предложение?
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the most interesting thing about the evolution of plants? Please explain your answer.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!