1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
15

Ability to be molded. A:density B:plasticity

Biology
1 answer:
sdas [7]3 years ago
3 0
The answer is B

Explanation. The density explains the amount of mass for how small or large an object is. Best way to test density is with water. If it is MORE DENSE (heavier in small area) it will sink.

Plasticity is to be molded. You can mold plastic is is bendable and heats up easily to give the advantage of being reshaped
You might be interested in
As a country progresses from the preindustrial stage to the postindustrial stage, what will happen to the birth rate and death r
AnnZ [28]

Answer:Both birth rate and death rate will decrease.

Explanation:

Demographic transition: The process whereby a country moves from high birth and death rates to relatively low birth and death rates.

The decline in death rate is due to better economic and social conditions of the country which leads to control of pre-existing diseases, better medical facilities,more food production,increased jobs,better sanitation and hence better quality of life.

Decline in birth rate is due to improved quality of life and also could be due to availability of family planning services in highly developed countries.Moreover access to education especially in female population has created awareness regarding birth control.

4 0
3 years ago
A border collie breeder raised border collies for herding cattle. She has 50 dogs, and lets them breed randomly. She has noticed
Svetach [21]

Answer:

20?

Explanation:

7 0
3 years ago
What is the process that turns water vapor into liquid, which causes the formation of a cloud.?
garri49 [273]
The process of physical change in state, that occurs when water vapor or gas converts into a liquid is condensation. According to the kinetic molecular theory, the particles lose kinetic energy and slow down and thus become more arranged and have a definite shape but an indefinite volume, a liquid.
5 0
2 years ago
Germination
Georgia [21]
c. is a process that occurs when the seed swells and breaks and growth occurs
4 0
3 years ago
With regard to the assessment of a patient's cardiovascular status, capillary refill time is most reliable in:
strojnjashka [21]
Hi the answer is in children who are younger than six years of age.
Hope this helps you.
7 0
3 years ago
Other questions:
  • Briefly summarize the "base-pairing rule"
    12·1 answer
  • The acidity or alkalinity of an environment influences microbial growth. The optimal pH for growth of bacterial with clinical si
    13·1 answer
  • Are black bear omnivore or carnivore?
    13·1 answer
  • Which process creates energy without the use of oxygen? a cellular respiration b photosynthesis c fermentation d electron transp
    13·1 answer
  • What are the three properties that mitochondria and chloroplasts share with prokaryotes
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The time interval for a parental cell to divide into two new daughter cells is called a. binary fission b. growth curve c. culti
    12·1 answer
  • Oil _____.
    11·1 answer
  • What is the advantage and disadvantage of drug abuse​
    7·1 answer
  • Plastic debris are a major source of marine pollution, endangering many marine mammals, birds and fish. computer simulations are
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!