1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
daser333 [38]
3 years ago
10

When it was announced that the offshore areas would be opened up, the government also said that extensive studies would need to

be performed before any oil could be produced. Some people were critical that the oil wouldn't be produced and delivered to people right away. What type of studies might need to be performed?
Biology
1 answer:
Sunny_sXe [5.5K]3 years ago
7 0

Answer:

Explanation:

Feasibilities studies-it analyzes a project to see if its possible technically, legally and financially.

Technical feasibility tells about if all the tools and equipment are available for the construction while financial talks of the financial ability.

Survey- They area of land where the offshore will be constructed will be surveyed and other surrounding environment to know the existing feature in such area of land that can pose threat to the offshore being constructed. This includes lives and houses built around the off shore to know how save their live is when the off shore built in such place.

You might be interested in
What is the role of krill in the Antarctic food web?
Alona [7]
A great amount of Antarctic animals feed on them. Whales, penguins, fish, birds, etc. They eat phytoplankton. 
6 0
3 years ago
Read 2 more answers
The study of health and disease within a geographic context and from a spatial perspective is
MAXImum [283]
The study of health and disease within a geographic context and from a spatial perspective is medical geography.

God bless!
3 0
3 years ago
1. Compare and contrast the functions of DNA and RNA.
xz_007 [3.2K]

Answer:

  • compare and contrast
  • DNA replication works
  • process of transcription

Explanation:

COMPARE AND CONTRAST:

DNA is a double-stranded molecule while RNA is a single-stranded molecule. DNA is stable under alkaline conditions while RNA is not stable. ...DNA and RNA base pairing is slightly different since DNA uses the bases adenine, thymine, cytosine, and guanine; RNA uses adenine, uracil, cytosine, and guanine

HOW IT WORKS:

How is DNA replicated? Replication occurs in three major steps: the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment. During separation, the two strands of the DNA double helix uncoil at a specific location called the origin.

PROCESS OF TRANSCRIPTION:

Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA molecule. RNA polymerase is the maintranscription enzyme. Transcriptionbegins when RNA polymerase binds to a promoter sequence near the beginning of a gene (directly or through helper proteins).

4 0
3 years ago
Which describes the changes in visible light moving from red to violet?
Aliun [14]

Answer:  Moving from red light to violet light, the energy increases. From equation 1 and 2, we say that energy is directly proportional to frequency and inversely proportional to wavelength.

8 0
2 years ago
6H20<br> How many H2O molecules is this?
vekshin1

Answer:

6

Explanation:

subscribe to Sky Clikz on YT to make your day better

6 0
3 years ago
Read 2 more answers
Other questions:
  • In which part of the circulatory system does the exchange of oxygen and dioxide take place between blood and cells?
    9·1 answer
  • The fact that little albert learned fear toward not only a white rat but also a ball of wool and a rabbit represents:
    8·1 answer
  • Which group of organisms contains chlorophyll and other pigments that enable them to harvest and use the energy of sunlight?
    7·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following cellular adaptations assist many unicellular organisms with locomotion?
    13·1 answer
  • Attached earlobes are recessive to free earlobes. If two heterozygous individuals have a child, what is the probability of the c
    12·1 answer
  • Give a pro and a con about human cloning
    15·1 answer
  • What is the main source of energy for the world
    6·1 answer
  • Please help <br> Is it <br> A<br> B<br> C<br> D
    7·1 answer
  • Consider the aquatic phosphorus cycle. Phosphorus is the limiting nutrient for aquatic organisms. Decomposition naturally return
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!