1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8090 [49]
3 years ago
13

Hello can someone please please me choose the right option

Biology
2 answers:
kykrilka [37]3 years ago
7 0

Answer:

Chimpanzees are the closest living relatives to humans. We share about 98.6% of our DNA with them. So your answer would be D. The closest living relatives to humans.

TEA [102]3 years ago
4 0

Answer:

The closest living relatives to humans

You might be interested in
Predator/prey relationships fall under which type of symbiosis?
Aleks [24]

Answer:

Parasitism

Explanation:

One organism benefits, and one is harmed.

3 0
3 years ago
Which of the following statements best supports Mendel's Law of Segregation?
SSSSS [86.1K]

Answer: The answer is C, the individual alleles that make up the gene must SEGREGATE (which means separate) during gamete formation, hence the name “law of segregation”

Explanation: Hope this helps

4 0
3 years ago
True or false, the more lean muscle mass, the more responsive your body will be to insulin.
Naily [24]

Answer:

True

Explanation:

A general misconception is that insulin is only involved in energy and fat metabolism.  When energy needs are high, insulin transports sugar from the blood into the muscle where it can be converted into energy.  When energy needs are low, insulin facilitates the conversion of excess sugar into fat where it can be stored for future use.

What is often overlooked is the powerful effect of insulin on stimulating muscle protein growth and repair.  An essential action of insulin is to increase the transport into muscle of amino acids, the building blocks of protein, where they can be used for rebuilding and repair. Insulin’s anabolic effects do not end there. Insulin also plays an important role in turning on one of the metabolic switches that control protein synthesis.

This action explains why combinations of carbohydrate and protein are far more effective in stimulating protein synthesis than protein alone.  Two switches are responsible for turning on protein synthesis.  One is activated by protein, specifically amino acid levels in the blood, and the second by insulin.  Consuming carbohydrate (which raises insulin levels) and protein in your recovery drink gives you a dual benefit.  In fact, research has shown that a carbohydrate protein drink is 38% more effective than a protein drink in stimulating muscle protein synthesis post exercise.

Another important effect of insulin is inhibition of protein breakdown.  At any given time, muscle protein is in a state of flux – it is being synthesized and broken down.  When more protein is synthesized than broken down, you have a net gain in lean body mass.  After exercise, protein degradation is higher, primarily because during extended endurance activity up to 20% of the working muscle’s energy is derived from protein.  That’s why consuming protein in your sports drink offers significant advantages.  It reduces the amount of muscle protein used for energy.  Higher breakdown rates of protein after exercise increases muscle soreness and slows the overall recovery process. By inhibiting protein breakdown, insulin mediates a faster recovery.

The bottom line – by taking advantage of how and when insulin works and how nutrition can affect insulin activity, endurance athletes can optimize muscle recovery and achieve significant improvements in endurance performance.

8 0
3 years ago
ATP is the energy currency we use in our bodies. The energy that is released from ATP when it is broken down comes from the ____
muminat

Answer: Oxidation of Glucose,Glycolytic reactions

Explanation:

4 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Other questions:
  • What is inside every cell in our body
    8·2 answers
  • Which is an example of insurance fraud?
    9·2 answers
  • Which of the 3 muscles have cells that are shaped like cylinders with pointy ends?
    9·1 answer
  • Deep water rises along the coast of Peru to replace surface water carried away from the coast by strong winds. Why is upwelling
    12·1 answer
  • Bacteria is used to produce human insulin because their reproduction is *
    8·1 answer
  • Jason Ormand was arrested on suspicion of sexual assault. The arresting officers did not give Jason his Miranda warnings. Jason
    5·1 answer
  • 1pt Place the following steps in the correct order:
    14·1 answer
  • Cells with 46 chromosomes are called _______ cells because they have two sets each.
    9·1 answer
  • Choose the best explanation of the difference between evolution and natural selection.
    7·1 answer
  • ASAP PLS HELP !!! Jfndndbrhdbdbr pls
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!