1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
9

When a cheese becomes moldy and is submerged in water does it increase in size

Biology
1 answer:
monitta3 years ago
5 0
<span> Mold will grow best in damp, dark and cool conditions, but can also grow in warmer temperatures as well. Mold grows best between 55 to 70 degrees Celsius.</span>
You might be interested in
An atom of argon has three electron shells, all of
nevsk [136]

Answer:

s

Explanation:

3 0
3 years ago
If a blue light shines on a green dress what colour would the dress be?​
DerKrebs [107]

answer: if you shine a blue light on a green dress the blue would be reflected

4 0
3 years ago
PLZ HELP ME!!!!<br> 2. What happens to sedimentary rocks on Earth’s surface?
Zanzabum

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

7 0
3 years ago
Read 2 more answers
What is the biome that a ostrich lives in
MAXImum [283]
The ostrich doesn't strictly live in one biome, while it is true that they live in a warmer, dryer climate most of the time. But they are also known to live in colder regions as well, they live a nomadic lifestyle, as long as they can find food and water they can live happily.
Hope this helps!
4 0
3 years ago
Coach Wood's class is trying determine what factor is most important in the growth of earthworms. Each day, they take the
Andrews [41]
D) the earthworm measurement is accurate because moore subtracted the beginning and ending points from the ruler
5 0
3 years ago
Read 2 more answers
Other questions:
  • You have a round pie plate filled with water. You carefully release a drop of red food coloring in the center of the plate until
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A plant absorbs energy from the sun. Where does the energy go from there?
    9·2 answers
  • Does online quiz help you to study for exam
    5·2 answers
  • How many blood cells do you have if you pop a artery
    9·1 answer
  • How could the call membrane then be important for homeostasis
    7·1 answer
  • What are some injuries where you don't feel pain?<br>​
    11·1 answer
  • Which of these is a solution?<br> O mercury<br> O apple juice<br> O concrete
    12·2 answers
  • Gas heating in Celsius
    5·1 answer
  • Name the tiny free floating organisms that live in both fresh water and salt water
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!