1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
3 years ago
8

WILL GIVE BRAINLIEST !!

Biology
2 answers:
QveST [7]3 years ago
7 0

The answer is carbon dioxide.

Hope this helps!!

Murrr4er [49]3 years ago
3 0

Carbon dioxide is produced in huge quantities due to smoke, vehicular exhaust, burning of fossil fuels for energy production.  It is also produced in large quantities on large dairy farms as gaseous waste from cows (flatulence) and from the decomposition of manure.

You might be interested in
How do blue whales catch their prey?
Damm [24]
They use their bristle like teeth called baleen. They filter out krill.
8 0
3 years ago
A space shuttle travels at the rate of 3,094 miles per hour to reach its orbit at a height of 300 km from Earth. If 1 kilometer
UkoKoshka [18]
After 10 min it is 60 kilometers from its destination
7 0
3 years ago
Read 2 more answers
Acetyl-CoA can be generated by which three metabolic pathways for potential use by the Citric Acid Cycle for energy metabolism?
Reika [66]

Answer:

C is the correct option.

Explanation:

Glycolysis is the standard way for the formation of acetyl-CoA, from glucose.

Second, beta-oxidation of fatty acids generates 2 acetyl-coA molecules per cycle.

Finally, the degradation of amino acids generates intermediates of the Krebbs cycle. Occasionally Leucine, tryptophan and isoleucine are directly catalysed in acetyl-CoA.

4 0
3 years ago
Where could the instructions be held to create a protein?
FromTheMoon [43]

Answer:

The correct answer is - in DNA molecules.

Explanation:

The instructions or the information for the creation of the protein is held in the DNA molecule inside the nucleus in eukaryotic organisms while present in the cytoplasm in prokaryotes.

The DNA molecule has coded all the information for the particular protein by the two processes transcription and translation. Transcription is the first step which makes a copy of the DNA is complementary in the form of mRNA, The second step involves the decoding mRNA into an amino acid chain with the help of ribosomes.

6 0
3 years ago
Nematodes and arthropods both .
Andrej [43]

The correct option is (C) Grow in conjunction with shedding of their exoskeleton.

The number of species in the superphylum Ecdysozoa is staggering. This is due to the presence of two of the most varied animal phyla, the Phylum Nematoda (which includes roundworms) and the Phylum Arthropoda (the arthropods).

<h3>What do nematodes and arthropods have in common?</h3>
  • The tough external covering of Ecdysozoans, known as the cuticle, is their most obvious identifying characteristic. These animals are shielded from predators, water loss, and other elements of their environment by the cuticle, which also acts as a robust yet flexible exoskeleton.
  • Every member of this superphylum undergoes periodic molting, or cuticle shedding, as they develop. They produce a fresh cuticle after molting that will protect them until their subsequent growth phase.
  • The process of molting and cuticle replacement, known as ecdysis, is how the superphylum earned its name.

Learn more about the Phylum Arthropoda with the help of the given link:

brainly.com/question/14184371

#SPJ4

6 0
1 year ago
Other questions:
  • What percentage of the deoxyribonucleic acid sample is thymine
    7·1 answer
  • Identity the items that are part of an ecosystem
    10·1 answer
  • Name three ecosystem services provided by biodiversity.
    12·2 answers
  • Which illustration has the correct direction in which an action potential travels through a neuron?
    15·1 answer
  • Consider the two biomes: tundra and desert. They are alike in some ways; different in others. The plants that live in both biome
    13·2 answers
  • What do you think stupor mean
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of the following statements in TRUE? Select one: a. Euchromatin is most easily viewed in interphase cells. b. Heterochroma
    11·2 answers
  • Describe the growth and development process of a typical annual plant
    10·1 answer
  • What is the name of the organic molecule modeled below? A propane B propene C propyne
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!