1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
il63 [147K]
3 years ago
15

In a forest ecosystem including rabbits, wolfs, foxes, and plants, what are two possible reasons the rabbit population might dec

line?
Biology
2 answers:
MaRussiya [10]3 years ago
7 0
One reason could be that there are a high number of predators killing rabbits in large quantities. Another is there may not be enough vegetation for the rabbits. They may also have a different animal competing for the same kinds of plants they eat. 
zlopas [31]3 years ago
7 0

Answer:

what the other guy said lol

Explanation:

You might be interested in
Which will experience greater acceleration ?
son4ous [18]

Answer:

C

Explanation:

According to Newton's second law, when the same force is applied to two objects of different masses, a. the object with greater mass will experience a great acceleration and the object with less mass will experience an even greater acceleration.

5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
How is crude oil brought to the surface
natta225 [31]
In some places, especially some new wells that have just been drilled,
the oil is under pressure, and it brings itself to the surface as soon as
you drill a 'pipe' for it to rise through.

In most oil wells, there's a pump bobbing up and down day and night,
pumping the oil up out of the well.

When the well is so old that even a pump isn't very effective, water is
often forced down the well under pressure, and the water forces the
oil back up through the pipe.
8 0
3 years ago
Which of the following processes releases energy to be used by a cell?
Marina CMI [18]
<span>D. a phosphate group is removed from ATP to form ADP.</span>
5 0
3 years ago
Read 2 more answers
The earthquakes experienced in California are related to tectonic plates because these catastrophic events are the result of -
ahrayia [7]

Answer:

A when two tectonic plates slide past each other.

Explanation: this answer is the most accurate because when two plates slide past each other they make a fault in the earth which creates an earthquake.

4 0
3 years ago
Other questions:
  • Are viruses alive? This question is debated among scientists throughout the world. Consider the following passage. Scientific re
    10·2 answers
  • The I band contains only _______ filaments.
    9·2 answers
  • Why might genetically identical twins have different phenotypes?
    10·1 answer
  • Why is the weight of an object more on earth then on the moon?
    13·1 answer
  • cell membranes are made of phospholipids which form a hydrophobic barrier. How does water pass through the cell membrane?​
    7·1 answer
  • quzilet Which of the following occurs when DNA is replicated? Group of answer choices One strand of the parent DNA is preserved;
    10·1 answer
  • The function of antibodies is to A. inject toxins into living pathogens. B. mark pathogenic cells for destruction. C. act as Tol
    10·1 answer
  • After something like gene flow occurs, natural selection will select the ______ variation.
    11·1 answer
  • Whales, birds, snakes, and fish need oxygen to survive. Even though they share this trait, these animals are not related because
    9·1 answer
  • What is the highest level of organization that ecologists study?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!