1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
atroni [7]
3 years ago
11

How do phagocytes help to fight infections

Biology
1 answer:
igomit [66]3 years ago
8 0

Phagocytes are crucial in fighting infections, as well as in maintaining healthy tissues by removing dead and dying cells that have reached the end of their lifespan. During an infection chemical signals attract phagocytes to places where the pathogen has invaded the body.


(hope this helps)

You might be interested in
Which is term for numbers that appear in the chemical formulas of some compounds
diamong [38]
The term for this is subscript
7 0
3 years ago
Read 2 more answers
Para que sirve los pantanos es
ozzi

Answer:

A swamp is a wetland that is forested. Swamps are considered to be transition zones because both land and water play a role in creating this environment. Many swamps occur along large rivers where they are critically dependent upon natural water level fluctuations. Other swamps occur on the shores of large lakes.

4 0
3 years ago
Explain thoroughly how “snow” occurs
KatRina [158]
When tiny ice crystals in clouds stick together to form snowflakes, the result is snow. If enough crystals form a clump, they'll become heavy enough to fall to the ground. When temperatures are cold and moisture in the form of tiny ice crystals exists in the atmosphere, snow forms.
6 0
3 years ago
Describe the role of bone morrow in the immune system. Explain why someone who has a genetic disorder that does not allow their
Nadya [2.5K]
 Bone marrow produces red blood cells, white blood cells, and platelets. The white blood cells (also called leukocytes) that our bone marrow produces are used to fight off diseases, and the platelets rush to a wound to form a layer over it, similar to a plate, to clot the blood and prevent bleeding. If your bone marrow dies or fails, your red blood cell count will dramatically decrease. A low blood cell count is called cytopenia. Someone who has a genetic bone marrow disease may be helped by a bone marrow transplant from a matching relative or donor. Before a transplant you get chemotherapy with or without radiation to kill off diseased red blood cells. During a bone marrow transplant you get injected with new, healthy red blood cells that make their way to your bone marrow to further grow and develop.
5 0
3 years ago
How do light intensity and distance affect the rate of photosynthesis? How do you know?
9966 [12]

Answer:

Light provides the energy needed for photosynthesis. Increasing the light intensity increases the rate of photosynthesis, provided plenty of carbon dioxide and water are available. ... This states that the intensity of light is inversely proportional to the square of the distance from the source.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What do you know about a chemical compound by looking at its chemical formula?
    13·1 answer
  • What is the most noticeable differences between the Hadeon period of
    12·1 answer
  • What is an ecological system consisting of all of its biotic and abiotic factors? A. community B. ecosystem C. habitat D. pure c
    9·2 answers
  • The polypeptide encoded by the glucose carrier gene has a signal sequence. As a result, the ribosome and the polypeptide that is
    8·1 answer
  • A strand of DNA has the following nitrogenous base sequence: ACGTAGCTA. The complementary DNA strand would be __________________
    10·1 answer
  • Which of the following virulence factors would most likely produce an organism that can hide within the host cell,
    15·1 answer
  • How does the almont of light the growth of a plant ?
    13·1 answer
  • Helpppp! which sentence explains why the moon can be seen from the earth at night
    11·1 answer
  • How can a change in biotic factors change the population of an organism? Use the word limiting factor in your response.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!