1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DanielleElmas [232]
3 years ago
14

Fossil belong on the cladogram?

Biology
2 answers:
Natasha_Volkova [10]3 years ago
8 0
No, cladograms deal with living species.
ZanzabumX [31]3 years ago
5 0

If this is the question:

"Consider the generalized cladogram of fish.

A fossilized fish is found that has jaws but no true bones. Where does this fossil belong on the cladogram?"

The answer is B.

Good Luck!

-RxL

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
The leaf is 4 inches long what kind of observation is this
lord [1]
It's an sight observation you're using your eyes to see it it's one of your 5th sences
8 0
3 years ago
Read 2 more answers
How is a tendon different from a ligament? A. A tendon joins a bone to a bone; a ligament joins a muscle to a bone. B. A tendon
rusak2 [61]
B is correct. A tendon will join a muscle to a bone, and a ligament joins a bone to another bone. I think of it this way, partly influenced by my biology teacher:

- The achilles tendon, at the back of your foot, clearly joins foot to calf muscle
- The word ligament comes from 'deligare' in Latin, which roughly means to tie           together. A ligament 'ties' two bones together

I hope this helps
6 0
3 years ago
Read 2 more answers
A nurse is required to initiate iv therapy for a client. which should the nurse consider before starting the iv?
sineoko [7]
The nurse should ensure that the prescribed medicine is clear and transparent.
6 0
3 years ago
Which is a difference between the Paleozoic and Mesozoic era?
solniwko [45]

Answer:

the animals

Explanation:

the difference between animal life in the Mesozoic Era and the early Cenozoic Era is that in the Mesozoic Era the reptiles were dominate and in the Cenozoic Era the mammals were dominate.

7 0
3 years ago
Other questions:
  • Which are characteristics of prokaryotic organisms? select three options ​
    7·1 answer
  • Are pictures of relationships
    13·1 answer
  • What is a test cross
    9·1 answer
  • Why does the presence of 22 large herbivore species at Mpala seem to contradict the competitive exclusion principle Dr. Pringle
    12·1 answer
  • Can someone tell me the right answer
    10·2 answers
  • Why are prokaryotes considered to be primitive compared to eukaryotes
    12·1 answer
  • Directions: Part 2 - Write your own skin scenario with FIVE or more sentences, using a completely different scenario than your 1
    9·1 answer
  • A negative tropism is when a plant grows towardaway from a stimulus.
    6·1 answer
  • In a community, before biomass is widely used as an energy source, several experts, including an ecologist,are hired to provide
    8·1 answer
  • What is the relationship between language and culture?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!