1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yakvenalex [24]
3 years ago
10

A self-assessment identifies your skills and interests for the purpose of______planning

Biology
1 answer:
kherson [118]3 years ago
5 0
Try using your on opinion and see what you can come up with and good luck
You might be interested in
Which biotic feature of a watershed helps prevent flooding?
kherson [118]
I thinks is C: Soil.
7 0
3 years ago
A circular molecule of DNA contains 1 million base pairs. If the DNA synthesis at a replication fork occurs at a rate of 100,000
lakkis [162]

Answer:

<h2>5 minutes </h2>

Explanation:

1. In bidirectional replication;  there are two replication forks, and each proceeding at a rate of 100,000 (as given in the question) nucleotides per minute.  

2. So, by  the given rate of replication, we can calculate that, it would require 5 minutes for the circular DNA molecule to be replicated by bidirectional replication because each fork synthesize  500,000 nucleotides in 5 minutes ( 100,000 per minute) ( as given, in 5 minutes × 100,000 nucleotides per minute= 500,000 and by 2 forks= 1,000,000) within the time period.  

4 0
3 years ago
Name 2 ways the forelimbs and hind limbs are different in a frog
azamat

Answer:

Frog forelimbs are typically short as the hind limbs are the principal limb pair generating propulsion.

3 0
3 years ago
Read 2 more answers
Please help me get the right answer PLEASE!?
skad [1K]

Answer:

protista

Explanation:

have a great day

5 0
2 years ago
Function of mannan in living organisms
vovangra [49]
Mannan-oligosaccharides (MOS) are prebiotics composed of complex carbohydrate molecules, derived from the outer cell wall of S. cerevisiae, whose main components, β-glucans (mannoproteins), are known as elements capable of activating the immune system of animals [3, 5]. :D
7 0
3 years ago
Other questions:
  • Sections of the digestive system type of break down what its being broken down to what is being absorbed
    5·1 answer
  • Identify and outline the process of condensation to form a disaccharide
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why aren't all organisms made of just one cell?
    10·1 answer
  • A dependent variable is ? a.directly changed by the experimenter ,B.manipulated by changes to the independent variable.,C.a vari
    10·1 answer
  • 3 advantages and disadvantages of the natural ecosystem<br>​
    14·1 answer
  • The heart is the major organ of the circulatory system. Which part of the body is responsible for delivering de-oxygenated blood
    11·1 answer
  • Relative Aging task cards
    10·1 answer
  • In treating victims of carbon monoxide poisoning, artificial respiration is first applied in the open air, followed by the admin
    14·1 answer
  • Cellular respiration is a series of metabolic processes in which the energy found in carbohydrates is transferred to atp true or
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!