1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yakvenalex [24]
3 years ago
10

A self-assessment identifies your skills and interests for the purpose of______planning

Biology
1 answer:
kherson [118]3 years ago
5 0
Try using your on opinion and see what you can come up with and good luck
You might be interested in
List nine limitations of science
DochEvi [55]

Answer:

1. Science only deals with observables

2. Science is limited by God

3. Models aren't reality

4. Science can't make value judgements

5. Science can't make value judgements

6. Can't prove universal negatives

7. Can't make moral judgement right and wrong

8. Can't produce final answers

9. Science is subject to biases and presuppositions

<h2>hope this helps :D</h2>

3 0
3 years ago
Read 2 more answers
How mant hands does spider has
Fynjy0 [20]

I believe you mean legs. If you do, the answer you are looking for is: All spiders have eight legs. They also have two small appendages at the front that are modified legs; these are called pedipalps.

4 0
3 years ago
Read 2 more answers
What is gobal warming ?
lidiya [134]

Answer:

b

Explanation:

because global warming is caused by an increase in earths temperature

3 0
2 years ago
Read 2 more answers
What can a cold or flu pill do for a body?
dezoksy [38]
They might lessen the symptoms
5 0
4 years ago
The is the root of the nail from which keratinized cells grow.
spin [16.1K]
The nail bed(sterile matrix)
3 0
3 years ago
Read 2 more answers
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What effect would the removal of a keystone species have on an ecological community?
    15·1 answer
  • How did Oswald Avery and his team of researchers affirm Griffith’s transforming principle?
    7·1 answer
  • Animals who eat the same food are categorized in the same niche. <br> True<br> False
    9·2 answers
  • PLEASE HELP !!!
    12·2 answers
  • A cell speedn aqqroximately _____ of its cycle in the M phase. 10%,30%,60%,90,%
    15·1 answer
  • Refer to the invertebrate cladogram above to answer the following questions.
    5·2 answers
  • Which of these does NOT contribute to animal extinctions?
    15·2 answers
  • Write importance of Charles Babbage i<br>n the evolution of computer​
    8·1 answer
  • How can one RNA molecule have more than one function?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!