1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
15

What prevents wind from blowing in a straight line from the North Pole to the equator?

Biology
1 answer:
Veseljchak [2.6K]3 years ago
5 0
"The Coriolis effect" is the one that prevents wind from blowing in a straight line from the north pole to the equator. The main reason for this effect is the spinning of our earth on its own axis. The earth spins faster near the equator than the poles. The reason is that the earth is wider near the equator. this causes the wind to deviate with the spin.


You might be interested in
Making rough estimates of physical quantities is useful so that
ollegr [7]
Making rough estimate of physical quantities is useful because it allow us to have an idea of how big or small a quantity is, it gives us the near result of the real quantity a matter contains. The approximate quantity obtained will give us information about the size of the quantity.
3 0
2 years ago
While caring for an infant receiving vitamin supplements, the nurse observes symptoms of exophthalmos in the infant. what is the
Damm [24]
You should have typed the question on Google instead of here
8 0
3 years ago
Example
chubhunter [2.5K]

Answer:

71

Explanation:

3 0
3 years ago
Mga impluwensya ng relihiyon sa lipunan,sining at kultura,politika at pagpapahalaga o moralidad​
goldenfox [79]

Answer:

Yes, Religion has a great influence on society.

Explanation:

Religion has a great influence on society, art, culture and politics because religious touch all these aspects of life. Religion is a way of life that is followed by the people in every aspects of life which directly affect the society and other related fields. A religious society follow their religion in their politics, culture and also in their architecture. So we can conclude that religious has a great influence on society, art, politics and culture of people.

6 0
2 years ago
I need help with this ASAP
Arisa [49]

Answer:

i would love to help you, but all of the answers are on the map...

Explanation:

:)

4 0
2 years ago
Other questions:
  • Compare the inputs and outputs of humans and robots in terms of matter and energy.
    12·2 answers
  • What is the purpose of a frogs heart cutaway
    9·2 answers
  • What causes the body to shift its metabolism to the production of ketone bodies?A. Excess protein. B. Excess fat. C. Shortage of
    5·1 answer
  • Cystic fibrosis is inherited in an autosomal recessive pattern. Males who have cystic fibrosis are usually sterile. Furthermore,
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • To see a whole insect under a microscope, you would probably not use a...
    13·1 answer
  • A portion of one DNA strand of the human gene responsible for cystic fibrosis is 5' ......ATAGCAGAGCACCATTCTG.....3' Write the s
    7·1 answer
  • In humans, the feet could be considered both ____________ and ____________ structures. (2 points) Question 5 options: 1) inferio
    8·1 answer
  • A child receives an x chromosome from its mother and a y chromosome from its father.What is true about this child?
    12·2 answers
  • Derived from a scandinavian word, a skulk is the group or collective name for what animal?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!