It is called Epiglottitis.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Smooth muscles (but depending on the specific type)
Warm air above the ocean rises making room for cooler air from the land
Saturated fatty acids lack double bonds between the individual carbon atoms, while in unsaturated fatty acids there is at least one double bond in the fatty acid chain. Saturated fats tend to be solid at room temperature and from animal sources, while unsaturated fats are usually liquid and from plant sources :)
