1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natali 33 [55]
2 years ago
9

Asking a question for my Lil sis :)

Biology
2 answers:
Lemur [1.5K]2 years ago
7 0

Answer: Deoxyribonucleic acid.

Explanation: DNA stands for deoxyribonucleic acid.

iris [78.8K]2 years ago
3 0
Deoxyribonucleic acid
You might be interested in
Interpret the Photosynti
kicyunya [14]

Answer:

The process of photosynthesis produces glucose which is a form of food for plants. The gas produced by photosynthesis is oxygen.

6 0
3 years ago
How to do project on cloning <br> Brief explanation plzzzz.....
Roman55 [17]
Think of a machine that can create the human race by saying like a piece of hair or someone can clone them hope this helped !
8 0
3 years ago
Help needed thx btw.
xeze [42]
Which of the following amino acids can function as a neurotransmitter in the CNS?

1. Glutamic Acid it's because the vital inhibitory neurotransmitter in the CNS.

2. Huntington’s chorea has been linked with a deficiency in the amino acid ______.

Gaba  because its the chief inhibitory neurotransmitter in the mammalian central nervous system. 

3. Which of the following is not considered a monoamine?

Adenosine this has nothing to do with neurotransmitters that's linked to the heart.
7 0
3 years ago
A recessive allele does not affect the phenotype of a heterozygous person.
Effectus [21]

Answer: A. true

Explanation: The phenotype is the physical characteristics of a person. So, if a person has brown eyes, which may be a characteristic that is dominant, then they would have a genotype of BB or Bb. The reason why Bb, heterozygous, is not a different color is because the recessive b does not affect the dominant B allele.

Hope this helps!!!

4 0
3 years ago
In which direction do arteries carry blood
nydimaria [60]

Answer:

Arteries carry blood away from the heart

Explanation:

Veins carry the blood back to the heart.

Hope this helps!

6 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What enables blood to flow through the body
    10·1 answer
  • Based on the current research progress, in the future, in which direction might liposomes break through in the field of food?
    13·1 answer
  • What would happen in an ecosystem without herbivores? A. The populations of secondary consumers would decrease.. . B. The popula
    9·2 answers
  • In January, a small number of Eastern Cottontail Rabbits were introduced into Red Forest. The population curve of the rabbits is
    10·2 answers
  • Which of the following is a slow environmental change?
    11·1 answer
  • Predict the type of relationship between the ant and the ant-lion.
    9·2 answers
  • Name the three fossil fuels and tell how Americans use them and the impact they have on our country?
    12·2 answers
  • Help me please.........​
    10·1 answer
  • What other things exist that are too small to be seen without magnification?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!