1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
5

Assume that the conversion of oxidized ubiquinone to reduced ubiquinone by NADH dehydrogenase occurs

Biology
1 answer:
natima [27]3 years ago
5 0

Answer:

The reduction of the oxidized ubiquinone led to the intake of two electrons as well as two protons from water molecules, as shown in Figure 14-19. The protons are further liberated during oxidation. If there is oxidation at one side and reduction at second side of the membrane,  There is the movement of one proton for every electron that moves through the membrane. Thus, the movement of electron by the oxidized ubiquinone influences the production of H+ gradient.

Explanation:

The reduction of the oxidized ubiquinone led to the intake of two electrons as well as two protons from water molecules, as shown in Figure 14-19. The protons are further liberated during oxidation. If there is oxidation at one side and reduction at the second side of the membrane,  There is the movement of one proton for every electron that moves through the membrane. Thus, the movement of an electron by the oxidized ubiquinone influences the production of the H+ gradient.

You might be interested in
How a partial charge is different from a net charge?
Contact [7]

Answer:

Partial charge is a non-integer charge value when measured in elementary charge units. Partial charge is more commonly called net atomic charge. ... For example, in a polar covalent bond like HCl, the shared electron oscillates between the bonded atoms.

7 0
2 years ago
PLS HELP!
lilavasa [31]

Answer:

evolution of life on Earth

Explanation:

Life began on Earth at least 3.5 to 4 billion years ago, and it has been evolving ever since. At first, all living things on Earth were simple, single-celled organisms. Much later, the first multicellular organisms evolved, and after that, Earth's biodiversity greatly increased.

7 0
3 years ago
, what location on Earth is receiving the most hours of sunlight? Why?
Phantasy [73]

Answer:

the equator gets the most sunlight

Explanation:

thia is because of the way that the earth is tilted on its axis.

floor gang aooh sub to pewdiepie

6 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
which type of contraction allows a muscle to produce tension without changing the angle of a skeletal joint
JulsSmile [24]

Answer:

isometric contraction

Explanation:

An isometric contraction occurs as the muscle produces tension without changing the angle of a skeletal joint. Isometric contractions involve sarcomere shortening and increasing muscle tension, but do not move a load, as the force produced cannot overcome the resistance provided by the load.

8 0
3 years ago
Other questions:
  • What is the name of the bond that is created when two amino acids join? hydrogen bond
    11·2 answers
  • CORRECT ANSWER WILL RECIEVE A MARK OF "THE BRAINLIEST ANSWER" Thanks so much! :)
    8·2 answers
  • Herman is a slim man who is 5 feet 10 inches tall and weighs 140 pounds. however, he has diabetes, a disease that usually occurs
    5·1 answer
  • What are the terms used to describe the movement of air into and out of the lungs?
    13·1 answer
  • Assume that a cell has 6 chromosomes while it is in the g1 stage of the cell cycle. how many chromosomes and how many dna molecu
    15·2 answers
  • The events indicated by * could affect a cell by​
    8·1 answer
  • Biologists use the system of binomial nomenclature developed by Linnaeus to assign scientific names to known living organisms. W
    15·2 answers
  • Which of the following best explains why ecosystems need a continual influx of new energy?
    9·2 answers
  • Where are we?
    14·1 answer
  • Where are phospholipids most likely found in a eukaryotic cell? group of answer choices ribosomes around organelles plasma membr
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!