Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer: D) a hollow soccer ball
Explanation:
Carbon is capable of forming many structurally different forms of the same element due to its valency. These forms are called allotropes. One of these is the buckminsterfullerene. It has a cage-like fused-ring structure made of twenty hexagons and twelve pentagons. If you look at this structure, it resembles a soccer ball.
Depending on the organism, the cell can get its energy from the sun (Plant; Photosynthesis) or through ATP energy (Animal).
Answer:
They camouflage
Explanation:
The peppered moths adapt to their surroundings. They blend in with their surroundings to avoid being eaten by their predators. Blending in with their surrounding also helps them to sneak up on and catch their prey.
I'm not too sure why they lay 100 eggs at a time but i think it's because the parents want to increase the survival of their eggs. Eggs sometimes are eaten by other animals and the parents want at least a few to survive.
Hello. You forgot to put the image so that this question can be answered, but I will describe what the image shows.
The image shows two types of "cups" that have a type of connection between the two. In cup A there is 1 mole of glucose and 1 mole of fructose. In cup B there is 0.1 mol of glucose and 1.5 mol of fructose.
Answer:
A. Solution A to Solution B
Explanation:
Balance is achieved when the "cup" with the lowest concentration of glucose receives glucose from the "cup" with the highest concentration, to the point that the two glasses establish equal concentrations of glucose between them.
We know that cup B has a lower concentration of glucose, which indicates that the movement of this solute was from cup A towards cup B. With this we can conclude that the letter A is the correct answer.
