1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
3 years ago
6

  A worm is living inside a cow and stealing nutrients from the cow's body, causing the cow to become malnourished. What type of

symbiotic relationship is this? 
      A. Organisms from the same species looking for the same resource  B. Two or more organisms looking for the same resource  C. Organisms from different species looking for the same resource  D. Adults outcompeting offspring for resources​
Biology
2 answers:
Nitella [24]3 years ago
7 0

I believe the answer is C.) Organisms from different species looking for the same resource

love history [14]3 years ago
5 0

Answer: C. Organisms from different species looking for the same

Explanation: they are both looking for nutirents.

You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Which one(s) contribute the most to the mass of a plant? 1. Soil Il. Carbon III. Water es ) I only B) || only c) I and III only
Eva8 [605]

Explanation:

i guess tha answer should be D

4 0
3 years ago
What may happen to an ecosystem of all primary consumers were removed
Airida [17]
It could be over run with the minor consumers and such causing massive problems
8 0
3 years ago
2. Organs are made up of vast numbers of cells that perform various tasks. When cells die within an organ, homeostasis is interr
forsale [732]

Answer:mos likely to survive but we’ll be injured

Explanation:

7 0
2 years ago
Is peritoneal dialysis more convenient or haemodialysis???
MaRussiya [10]

Answer:

Explanation:

peritoneal dialysis is more convenient than haemodialysis because it include more lifestyle flexibility and independence and less restriction of diet as compared to haemodialysis

8 0
3 years ago
Other questions:
  • Any organism in which the dna has been altered using recombinant dna technology is considered a genetically modified organism. a
    9·1 answer
  • A dermatome represents the motor innervation of muscles in what area.
    11·1 answer
  • During the first ____ year(s of life, a baby's brain will establish billions of new connections between neurons.
    15·1 answer
  • What is a protein that is the main component of the thick filaments in muscle fibers and is responsible for muscle contraction?
    6·1 answer
  • Which explains how winds cause waves?
    7·1 answer
  • 1. What is the limiting factor for most animal life in the open ocean?
    14·1 answer
  • What term do historians use to describe the personal preferences that people have that affect their interpretation of events?
    15·1 answer
  • Moshe is a writer. He is creating content for an informative chart to be placed near the coral reefs for the visitors to the ree
    10·2 answers
  • Why are urine samples kept in a refrigerator before testing?
    12·1 answer
  • It is possible to experience a solar eclipse during a full moon. Question 3 options: True False
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!