1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
5

If Jacques were to hold his breath the air in his lungs would be kept at a constant temperature. Would it be safe for Jacques to

hold his breath while ascending from the bottom of the lake to the surface?
Biology
1 answer:
zzz [600]3 years ago
6 0

Answer:

It isn't safe at all...

Explanation:

Even if remains at constant temperature, while ascending to the surface of the lake Jacques lung pressure will increase if he hold its breath. Thats because the pressure of water weakens and the pre-hold breath in lungs will expand as he rises. This can cause serious lung damage and drowning is possible.

You might be interested in
In a recessive disorder, a person will only have the disorder if they have one copy of the allele
Gnesinka [82]

Answer:

False

Explanation:

Since it's a recessive disorder that means the presence of the dominant allele will overshadow the recessive if it's present. Two recessive alleles have to be present in order for the person to have the disorder.

4 0
3 years ago
Why are viruses considered nonliving but bacteria are considered living? Give two reasons.
nikklg [1K]

Answer:

1-Viruses also lack the properties of living things: They have no energy metabolism, they do not grow, they produce no waste products, and they do not respond to stimuli.

2-They also don't reproduce independently but must replicate by invading living cells.

7 0
3 years ago
Read 2 more answers
The antiparallel arrangement within DNA molecules refers to Select one:
mylen [45]

Answer:

c. one helix strand that runs from the 5' to 3' direction and the other strand runs from the 3' to 5' direction.

Explanation:

A DNA molecule has <em>two strands of nucleotides with a sugar phosphate backbone each, but orientated on the opposite direction </em>allowing for the base pairs to complement one another, making it a more stable structure. <em>When two biopolymers run parallel to each other but with opposite directionality (alignment) we have an antiparallel arrangement.</em>

I annexed an image of the DNA structure.

I hope you find this information useful and interesting! Good luck!

4 0
3 years ago
Organelles are structures within the cell that perform important functions. Which of the following correctly matches the
Firdavs [7]

Answer:

mitochondria: <u>powerhouse of the cell</u>

Ribosomes<u>: the places where proteins are synthesized in our cells. </u>

nucleus <u>houses DNA;controls cell</u>

Vacuole: <u>holds waste and fluids from cell</u>

Ribosomes: <u>tiny organelles that contain RNA and specific proteins within the cytoplasm. </u>

Explanation:

Organelles make up the subunits of a cell.  There are numerous each with their own function.  

3 0
3 years ago
Which is NOT an example of a biome? (Hint: Biomes are very large ecological areas on the earth’s surface, with fauna and flora (
scoray [572]

Answer:

\boxed{\bold{Lake}}

Explanation:

  • <u>A Lake Is -Not- A Biome</u>

<u></u>

Biomes: T<u>emperate Deciduous Forest, Coniferous Forest, Woodland, Chaparral, Tundra, Grassland, Desert, Tropical Savanna</u>

<u />

A lake is not a biome. A lake can be found in a biome, but a lake is not itself a biome. A biome is a community of plants and animals that have common characteristics for the environment they exist in. Yes, similar species can be found living in a lake, but a lake can be found in a particular biome where there are lots more of the same species.

- Mordancy

3 0
3 years ago
Other questions:
  • 80%
    8·1 answer
  • *<br> Bacteria are an example of...<br> a.Viruses<br> b.Eukaryotic cells<br> c.Prokaryotic cells
    10·2 answers
  • In plants, the ultimate electron donor in photosynthesis is?
    15·1 answer
  • How to remember the word equation for photosynthesis?
    9·1 answer
  • In which situation is a chemical reaction occurring? A. ice melts B. a nail rusts C. a glass breaks
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is believed to be the most significant result of the evolution of the amniotic egg?
    7·1 answer
  • This inner planet takes 365 days to orbit the sun
    7·2 answers
  • Word Bank; Cytokinesis, G1, G2, S, Interphase, Mitosis 1. Stage where the cell divides into 2 daughter cells with identical nucl
    9·1 answer
  • How is an E transfer different from an E transformation? *
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!