1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
4 years ago
6

The phase in which DNA copies itself

Biology
2 answers:
baherus [9]4 years ago
8 0
It is called replication which happens during interphase.
Black_prince [1.1K]4 years ago
8 0
The phase in which DNA copies itself is called the S phase. There are 4 stages, G1, S, G2, and M. 
You might be interested in
Why is the world so round?!?!
belka [17]
Because gravity pulls towards the center of the earth evenly in all directions, giving earth a spherical shape.
6 0
3 years ago
Read 2 more answers
Which two hypotheses can be supported with quantitative data?
Rainbow [258]
That would be A and E.

because u can measure or calculate the variables in these 2 hypotheses. (Amount of protein is diet, muscle mass, salt intake, blood pressure.)
4 0
3 years ago
Read 2 more answers
Explain how Magma and Sediments are formed? What happens to magma when it cools? What happens to sediments when it becomes compa
Vadim26 [7]

Answer:

Magma is formed when hot liquid comes from the earth's core into the cold crust of the Earth. When this liquid solidifies it loses heat to the surrounding crust and begins to melt the surrounding rock.

Sediments are formed when magma rises to Earth's surface from a volcanic eruption where the magma cools into igneous rock. On the surface, weathering and erosion break down the igneous rock into pebbles, sand, and mud, creating sediment, which accumulates in basins on the Earth's surface.

When sediment becomes compacted and cemented together it forms a type of rock called sedimentary rock

4 0
3 years ago
A microscopic view of mildew fungus displays thin, threadlike filaments, which take nutrients from the host cell. What are these
Marrrta [24]
The answer is: hyphae
I hope this helps!
3 0
4 years ago
In a food web, a lot of energy is dispersed into the environment as ____________.
Arte-miy333 [17]
Nitrogen ......................
4 0
3 years ago
Read 2 more answers
Other questions:
  • A vein in a leaf has what important function?
    7·1 answer
  • In which phase do the molecules take the shape of the container?
    14·2 answers
  • The hydrolysis of GTP to GDP carried out by tubulin molecules Group of answer choices provides the energy needed for tubulin to
    10·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which two components are raw materials used in cellular respiration
    12·1 answer
  • The gulf flounder is a fish that is found in the Gulf of Mexico. It
    5·1 answer
  • The animal like parasite plaramodum causes the disease
    8·1 answer
  • Any organism that eats other animals.
    7·2 answers
  • 20 POINTS + A BRAINLIEST!!!
    8·2 answers
  • Describe how oxygen is obtained by the Flatworms.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!