1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jarptica [38.1K]
3 years ago
8

When a response becomes generalized, then someone will react to things that remind them of the first stimuli that caused a respo

nse. Please select the best answer from the choices provided T F
Health
2 answers:
Inessa05 [86]3 years ago
6 0

When a response becomes generalized, then someone will react to things that remind them of the first stimuli that caused a response. Please select the best answer from the choices provided True

Arisa [49]3 years ago
3 0

The best answer is true

You might be interested in
If you notice files being transferred to or from your computer a. Simply close the window c. Tell the lab instructor b. Open a n
Lyrx [107]

Answer:

D.

Explanation:

you should do all you can. and D. seems to be doing the most

3 0
3 years ago
SOMEONE"S GOTTA HAVE A BRAIN FOR THIS, PLEASE HELP
gladu [14]

Answer:

the awnser is

Explanation:

7 0
3 years ago
Which STD can cause blindness in a newborn baby if it infects the baby's eyes during the birth process while producing a greenis
Anika [276]
Syphilis is the STD that can cause blindness in people. Babies can contract the disease from mother to child. 
8 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
what injury does not require treatment to prevent contamination? a. cut on hand. b. hangnail on middle finger. c. burn on thumb.
Step2247 [10]
B a hangnail is the only one that has not broken the skin and won't get infected
4 0
3 years ago
Read 2 more answers
Other questions:
  • The term pharmacist was first used by
    10·1 answer
  • Which food groups are considered good sources of complete proteins?
    8·2 answers
  • Quiz 10 points about the heart
    8·1 answer
  • The form filed by students to receive federal financial aid for school is known as
    10·1 answer
  • Sense of self is called your
    13·2 answers
  • Which of the following choices is the closest in size to one serving of meat?
    6·2 answers
  • Which system transports nutrients to body cells?
    5·2 answers
  • I'll give 50 PTS if you write me an 3-4 PARAGRAPHS about "why is physical education and physical activity so important for our h
    10·1 answer
  • Smoking decreases the
    8·1 answer
  • Hy i need help for a Physical Education Portfolio 5 grade and 4 sentences
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!