1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shtirl [24]
3 years ago
10

If a physical change has taken place, which of these is most likely true?

Biology
2 answers:
Katena32 [7]3 years ago
6 0

A physical change means that none of the atoms or chemical bonds have been changed inside of something. Therefore, if you make a physical change, you should be able to revert it back. That means that the answer to this question is "The changed substance retains its unique properties." because it is the only answer choice where nothing major is being changed. The rest of the answer choices indicate that once changed, it isn't able to be changed back.

Galina-37 [17]3 years ago
4 0

Answer:

B

Explanation:

You might be interested in
Colorblindness is a recessive X-linked disease. The pedigree below demonstrates colorblindness in a
shtirl [24]

Answer:

Honestly I don't know.

Explanation:

4 0
3 years ago
1.Explain what makes a scientific experiment reliable. Be sure to include at least three reasons to support your answer.
Reil [10]

An experiment is reliable when its repetition produce always the same result. In science, peer review is fundamental because this process ensures that there is not misleading data that may lead to erroneous results.

  • In sciences, reliability is a term used to evaluate the quality of research. Reliability refers to the probability that an experiment or result is correct, thereby preventing and mitigating failures over time.  

  • An experiment whose successive repetitions conduct the same result is 100% reliable.  

  • Three examples of reliability in science:
  1. the same measurement of the size of the leg of a spider.
  2. the observation of the same behavior of birds populations on different days and at different times of the day.
  3. the same byproducts from a given chemical reaction when an experiment is repeated two or more times.

  • Peer review is the most widely accepted process used to validate scientific data. This process (peer review) is fundamental to facilitate the growth of scientific knowledge.

  • During peer review, independent scientists assess the originality, reliability, and significance of a scientific work before its publication.

Learn more in:

brainly.com/question/9292757?referrer=searchResults

5 0
3 years ago
___ has the greatest influence on the resting membrane potential
Svetach [21]
Potassium has the greatest influence on the resting membrane potential. Resting membrane potential is caused by the differences in the concentrations of ions inside and outside the cell. At resting membrane potential there are more sodium ions outside the neuron and more potassium ions inside the neuron. For a neuron the resting membrane potential is about -70 mV. 
4 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
The sensory receptors, neurons and pathways make up the ________ division of the nervous system
olga nikolaevna [1]

Answer:

afferent division

Explanation:

Receptors, sensory neurons, and sensory pathways make up the afferent division of the nervous system.

7 0
2 years ago
Other questions:
  • List five scientist that contributed to cell theory
    7·1 answer
  • Studying the folding patterns of protein molecules can help microbiologists better understand cellular processes as well as some
    7·1 answer
  • Classify the planets!!!!
    7·1 answer
  • What are four main functions of bones? protect organs, strengthen muscles, make skin cells, store nutrients strengthen muscles,
    10·2 answers
  • Which structure is unique to plant cells? A.cell membrane B.centriole C.cell wall D.vacuole
    15·2 answers
  • Read the excerpt from Nathaniel Hawthorne's "Dr. Heidegger's Experiment," and then match the characters with the traits they rep
    14·1 answer
  • What type of climate would you predict at the top of Mount Everest, which has a height of 8,848 meters?
    13·1 answer
  • Separation of the alleles of a single gene into different gametes is called
    7·1 answer
  • Question 5 of 25
    13·1 answer
  • Increased secretion by all the salivary glands results from:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!