1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zinaida [17]
3 years ago
7

Which land biome covers the largest percentage of land?

Biology
2 answers:
velikii [3]3 years ago
5 0
~Hello there!

Your question: Which land biome covers the largest percentage of land?

Your answer: Desert is the land biome that covers the largest percentage of land.

Hope this helps!
uysha [10]3 years ago
5 0

Answer:

Your answer would be DESERT!! GRADPOINT Good luck! ;)

You might be interested in
A person who is interested in learning more about how glands produce and release hormones might pursue a career in
Nuetrik [128]

endocrinology

Explanation:

the answer is likely to be endocrinology because it deals with glands and hormones

7 0
2 years ago
What technique is used to separate the different cell parts? Select one: a. all of the above b. microscopy c. cell fractionation
enot [183]

Answer:

The correct answer is c. cell fractionation

Explanation:

Cell fractionation is the technique which allows different cells part to be separated from each other on the basis of their density gradient by using a centrifuge.

In cell fractionation, first the cell wall and membrane of cells are broken by chemical, physical or mechanical method. Then the cell component can be separated by centrifuging them at different rpm.  

Components that have higher density can be found in the bottom and the light density can be found on top of the tube. Therefore the correct answer is c. cell fractionation.

8 0
3 years ago
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
3 years ago
Steroid hormones bind to receptors inside the cell and alter their conformation. The hormone-receptor complex is then transporte
Studentka2010 [4]

Answer:

It must be transported through the nuclear pore complex.

Explanation:

Steroid hormones bind to receptors inside the cell and alter their conformation. The hormone-receptor complex is then transported into the nucleus, where it can directly affect gene expression. To get from the location where the receptor binds the hormone to its site of action, the hormone-receptor complex must be transported through the nuclear pore complex.

7 0
3 years ago
When a sperm cell and an egg emerge, they undergo the process of fertilization and give rise to a?
nekit [7.7K]
They give rise to a zygote(?).
5 0
3 years ago
Other questions:
  • A characteristic of most mollusks is
    11·1 answer
  • Along with plants and algae, in which organisms can photosynthesis occur
    8·1 answer
  • Liverworts and mosses were some of the earliest land-based plants. Which statement correctly explains why these species are stil
    8·2 answers
  • Keystone predators often help maintain ecological stability in a community if they
    11·1 answer
  • Your friend, Lacy, is suffering from a deficiency of iron. Explain how
    9·1 answer
  • Science. Which student is correct?
    11·1 answer
  • How many valence electrons does this atom have? How do you know?
    9·1 answer
  • Plz help me well mark brainliest if correct!!
    12·2 answers
  • Ancient prokaryotes may have entered primitive eukaryotic cells, remained there, and evolved into organelles. InferIs it likely
    8·1 answer
  • If a doctor attempts to trigger the patellar tendon reflex and a lack of response occurs, what are potential regions where patho
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!