1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna11 [192]
2 years ago
6

Which of the following is not true about the cell membrane?

Biology
1 answer:
ArbitrLikvidat [17]2 years ago
7 0
The answer is C I believe
You might be interested in
If all grasshoppers are removed from the food chain, what will happen to the blue birds
swat32

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

7 0
3 years ago
Read 2 more answers
On average how much energy is passed from one trophic level to the next
insens350 [35]

Answer:

10

Explanation:

reply if helped

4 0
3 years ago
10.   An example of an atom that has no charge is one that has
Kruka [31]
Is called a neutral atom
4 0
3 years ago
What happens during the initiation step of DNA transcription? A ribosome attaches to the initiation codon of a completed mRNA st
Amanda [17]

Answer:

<u>A portion of the DNA unwinds and RNA polymerase attaches to the DNA within the transcription bubble.</u>

Explanation:

Transcription is the process in which DNA template is used to synthesize  mRNA.

There are three steps of transcription:

  • <u>Initiation</u>

It is the process in  which a portion of DNA unwinds and RNA polymerase binds to the promotor region on the DNA.

  • <u>Elongation</u>

It is the process in which RNA polymerase moves along the DNA template and synthesizes mRNA. During this process, unwinding of double stranded DNA takes place.

  • <u>Termination</u>

As the RNA polymerase moves along the DNA template, it finally reaches a termination signal and then stops synthesizing. It is followed by the detachment of the newly formed mRNA and RNA polymerase from the DNA.

<u>QUESTION:</u>

  • <u> A ribosome attaches to the initiation codon of a completed mRNA strand.</u>

This is the incorrect answer choice as this process does not happen in the process of transcription. This event happens<u> in the process of translation in which mRNA is used to synthesize proteins or amino acids. mRNA attaches to ribosome during this process.</u>

  • <u>RNA polymerase moves along the template strand of the DNA creating an mRNA strand.</u>

This is the incorrect answer choice as this event takes place in the process of elongation.

  • <u>A portion of the DNA unwinds and RNA polymerase attaches to the DNA within the transcription bubble.</u>

This is the<u> correct answer choice as this event takes place in the process of initiation of transcription</u>

  • <u>The mRNA detaches from the RNA polymerase as the RNA polymerase leaves the DNA strand.</u>

This is the incorrect answer choice. This event takes place in the event of termination of transcription.

3 0
3 years ago
glucose is _____during photosynthesis...A: formed B: a rectant C: converted D: reacts with water and carbon dioxide
solmaris [256]
A formed, photosynthesis, uses sunlight and carbon an uses it for energy or glucose
6 0
3 years ago
Read 2 more answers
Other questions:
  • Study the diagram. An ocean with points labeled 1 through 6. Water level scale is on the left, from 0 kilometers to 15 kilometer
    8·2 answers
  • Which structure would a unicellular organisms most likely have to move around?
    7·1 answer
  • Using data, provide evidence that evolution is an ongoing process.
    11·1 answer
  • What role do converging plates play in the formation of volcanoes
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following statements about artificial erosion is true?
    10·2 answers
  • What is the name of this plant and which category is this parasitic,Insectivorous plant and saprophytice plant?
    6·1 answer
  • Please select the word from the list that best fits the definition
    10·1 answer
  • When the diaphragm contracts, the size of the thoracic cavity ________, the pressure inside the thoracic cavity ________, and ai
    9·1 answer
  • What is the monomer of a carbohydrate?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!