1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
3 years ago
11

Which of the following is true about DNA

Biology
2 answers:
Alex_Xolod [135]3 years ago
8 0
The last on it makes copied of itself.
vredina [299]3 years ago
5 0
I think its D.
- i´m not sure
                 Hope this Helps
If you have any other questions please contact me here at Brainly.com and i will be happy to help.
                   -Diane
You might be interested in
Which term describes a detrivore
xenn [34]
A detritivore, also known as a detrivore, are heterotrophs or decomposers that act as nature's recyclers and feed on dead organic material/remains
4 0
3 years ago
Read 2 more answers
Which structure in the heart'separates<br> oxygenated blood from deoxygenated blood?
lisabon 2012 [21]

Answer:

pericardium

Explanation:

A double-walled membrane, the pericardium, separates the right and left chambers, preventing oxygen-rich blood from mixing up with the one without oxygen. So, the heart functions go smoothly. Deoxygenated blood enters the right atrium.

6 0
3 years ago
What happens when a cell reaches the Hayflick limit ? Why does this have to happen for the health of the cell?
DENIUS [597]

Answer:

The Hay-flick Limit is a concept that helps to explain the mechanisms behind cellular aging. The concept states that a normal human cell can only replicate and divide forty to sixty times before it cannot divide anymore, and will break down by programmed cell death or apoptosis.

4 0
3 years ago
As he is male, paulo has higher levels of the hormone testosterone in his body than his sister liette. given paulo's higher test
Vinvika [58]

<span>Being male, the levels of the hormone Testosterone is higher in Paulo’s body than in his sister, Liette’s body. As a result of the higher testosterone levels in Paulo’s body, it’s reasonable to expect him to experience greater physical aggression than his sister.</span>

5 0
3 years ago
Co způsobuje malarii
butalik [34]

Malárie je způsobena parazity Plasmodium. Paraziti se k lidem šíří kousnutím infikovaných samic komárů Anopheles, nazývaných „vektory malárie“. Existuje 5 druhů parazitů, které způsobují malárii u lidí, a 2 z těchto druhů - P. falciparum a P. vivax - představují největší hrozbu

4 0
3 years ago
Other questions:
  • Cow's milk should never be fed to infants because it is too high in protein and too low in sodium. select one:
    13·1 answer
  • 23. Where is the warm sector located in reference to a developed mid-latitude cyclone over the United States? a. To the north c.
    10·2 answers
  • Which population dispersion pattern is most commonly seen in the field for most species?
    5·1 answer
  • Identify the organelle with the following structure or function from the list below:
    12·1 answer
  • The stimulation of an inadequate number of sodium channels for the generation of a positive sodium channel feedback loop is cons
    15·1 answer
  • The leaves at the top of a tree’s canopy are exposed to direct sunlight during the day, and their phytochromes will occur in a h
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 50 Points and brainliest!!!
    11·1 answer
  • All of the following are differences in transcription, RNA processing, and translation between prokaryotes and eukaryotes except
    7·1 answer
  • Can someone please help me with these? worth 50 points plus brainliest!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!