1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
4 years ago
10

How long can you will for you to go unconscious when you stop your breathing?

Biology
1 answer:
defon4 years ago
7 0

People typically develop serious and possibly irreversible brain damage after 5 to 10 minutes of not breathing. Brain cells begin to die after 1 minute without oxygen. Serious brain damage is likely within 3 minutes without breathing.

You might be interested in
How to convert clesuis to kelvin
Kisachek [45]

Explanation:

Celsius can be converted to Kelvin by adding 273.15 to the Celsius grade!

3 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
During respiration, members of the animal kingdom use ______ and then release ______ as a waste gas.
eduard
Oxygen; carbon dioxide
8 0
3 years ago
Which event occurs in photosystem I?
Firlakuza [10]

<u>Photosystem I is an integral membrane protein complex that uses light energy to catalyze the transfer of electrons across the thylakoid membrane from plastocyanin to ferredoxin. Ultimately, the electrons that are transferred by Photosystem I are used to produce the high energy carrier NADPH.</u>

5 0
3 years ago
Can someone please answer this, the article will help a lot. 8 points. Thank you
slava [35]
There is no article.
8 0
4 years ago
Read 2 more answers
Other questions:
  • What are the terms used to describe locations on a sand dune?
    6·2 answers
  • The process in which rock layers in different regions are matched is
    13·1 answer
  • Which best describes red blood cells? A. They are colorless B. They protect against disease-carrying microorganisms C. They tran
    5·2 answers
  • What is the difference between a missense mutation and a silent mutation..
    9·1 answer
  • How does energy from the sun affect the motion of molecules in a gas compared to molecules in a liquid?
    11·1 answer
  • Jill stepped on a tack. Which part of the central nervous system caused her foot to move off the tack quickly in a reflex respon
    5·2 answers
  • Coastal areas near a cold-water current are _______ and _____ than regions farther inland.
    14·1 answer
  • Your body receives the same amount of energy from 1 gram of fat as it does from 1 gram of iron.
    13·1 answer
  • Tiying pe
    6·1 answer
  • Molecular basis of non infectious diseases
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!