1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
3 years ago
11

Describe a spring tide and how does high and low tide change during a sprint tide?

Biology
1 answer:
Dmitriy789 [7]3 years ago
3 0

Explanation:

The definition of a spring tide is a flood or rising of water especially during a new or full moon. ... A tide in which the difference between high and low tide is the greatest. Spring tides occur when the Moon is either new or full, and the Sun, the Moon, and the Earth are aligned.

Waves are additive so when the gravitational pull of both bodies is in the same direction the high tides add and the low tides add (Figure below). Highs are higher and lows are lower than at other times through the month. These more extreme tides, with a greater tidal range, are called spring tides.

You might be interested in
The cells of collenchyma have evenly thickened cell wall true or false?
abruzzese [7]

Answer:

False

Explanation:

The cells of collenchyma have evenly thickened cell wall

Please Mark me brainliest

5 0
3 years ago
Our understanding of DNA and gene expression has dramatically increased over the last 50 years. Describe 2 positive impacts and
lozanna [386]

Positive impacts of genetic engineering:

• New products are created such as food with higher nutrition values, drugs that are more effective and safer

• Disease prevention (“correcting” the genetic mutation, or removing disease-causing gene)

Negative impacts of genetic engineering:

• irreversible side effects, for example resistance of bacteria or introduction of viruses in human cells

• abusing like change specific traits that are not connected with diseases, create human outcomes that are ethically questionable.


3 0
3 years ago
ASAP PLEASE HURRY thank you​
Strike441 [17]

Is this problem multiple choice? I remember much of biology but I'm blanking on vocab

6 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Purines and primidens are the two types of nitrogens.basis in nuclic acid,breifly explain both of them
Aleks [24]

Answer:

Pyrimidines

Uracil = 2,4-dioxy pyrimidine

Thymine = 2,4-dioxy-5-methyl pyrimidine

Cytosine = 2-oxy-4-amino pyrimidine

Orotic acid = 2,4-dioxy-6-carboxy pyrimidine

Polynucleotides

Nucleotides are joined together by 3'-5' phosphodiester bonds to form polynucleotides. Polymerization of ribonucleotides will produce an RNA while polymerization of deoxyribonucleotides leads to DNA.

https://library.med.utah.edu/NetBiochem/pupyr/pupy15.gif

Explanation:

5 0
2 years ago
Other questions:
  • What is the main function of xylem tissue in the plant transport system?
    5·1 answer
  • Which statement about nuclear fission is correct? produces very little energy produces a lot of air pollution requires large amo
    11·1 answer
  • According to the theory of global warming which statement is the most likely reason for the current climate change?
    12·1 answer
  • What is a cow that has not had children called
    13·1 answer
  • What are the layers of your skin called?
    9·2 answers
  • Which of the following is the best description of the events occuring during anaphase I of meiosis?
    6·1 answer
  • Plant cell can prepare their own food. Why?​
    8·2 answers
  • In the scientific name Puma concolor, Puma is consider the
    8·1 answer
  • Wer<br>Should both of drinks Wand X be taken off the shelves? Why? *​
    15·1 answer
  • Explain what is ecological conservation and conservation of the environment. What can you do to conserve the environment? Why do
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!