Answer:
False
Explanation:
The cells of collenchyma have evenly thickened cell wall
Please Mark me brainliest
Positive impacts of genetic engineering:
• New products are created such as food with higher nutrition values, drugs that are more effective and safer
• Disease prevention (“correcting” the genetic mutation, or removing disease-causing gene)
Negative impacts of genetic engineering:
• irreversible side effects, for example resistance of bacteria or introduction of viruses in human cells
• abusing like change specific traits that are not connected with diseases, create human outcomes that are ethically questionable.
Is this problem multiple choice? I remember much of biology but I'm blanking on vocab
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
Pyrimidines
Uracil = 2,4-dioxy pyrimidine
Thymine = 2,4-dioxy-5-methyl pyrimidine
Cytosine = 2-oxy-4-amino pyrimidine
Orotic acid = 2,4-dioxy-6-carboxy pyrimidine
Polynucleotides
Nucleotides are joined together by 3'-5' phosphodiester bonds to form polynucleotides. Polymerization of ribonucleotides will produce an RNA while polymerization of deoxyribonucleotides leads to DNA.
https://library.med.utah.edu/NetBiochem/pupyr/pupy15.gif
Explanation: