All categories

3 years ago

Describe a spring tide and how does high and low tide change during a sprint tide?

Biology

1 answer:

Dmitriy789 [7]3 years ago

3 0

Explanation:

The definition of a spring tide is a flood or rising of water especially during a new or full moon. ... A tide in which the difference between high and low tide is the greatest. Spring tides occur when the Moon is either new or full, and the Sun, the Moon, and the Earth are aligned.

Waves are additive so when the gravitational pull of both bodies is in the same direction the high tides add and the low tides add (Figure below). Highs are higher and lows are lower than at other times through the month. These more extreme tides, with a greater tidal range, are called spring tides.

You might be interested in

The cells of collenchyma have evenly thickened cell wall true or false?

abruzzese [7]

Answer:

False

Explanation:

The cells of collenchyma have evenly thickened cell wall

Please Mark me brainliest

5 0

3 years ago

Our understanding of DNA and gene expression has dramatically increased over the last 50 years. Describe 2 positive impacts and

lozanna [386]

Positive impacts of genetic engineering:

• New products are created such as food with higher nutrition values, drugs that are more effective and safer

• Disease prevention (“correcting” the genetic mutation, or removing disease-causing gene)

Negative impacts of genetic engineering:

• irreversible side effects, for example resistance of bacteria or introduction of viruses in human cells

• abusing like change specific traits that are not connected with diseases, create human outcomes that are ethically questionable.

3 0

3 years ago

ASAP PLEASE HURRY thank you

Strike441 [17]

Is this problem multiple choice? I remember much of biology but I'm blanking on vocab

6 0

3 years ago

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39

umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.

Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.

6 0

2 years ago

Purines and primidens are the two types of nitrogens.basis in nuclic acid,breifly explain both of them

Aleks [24]

Answer:

Pyrimidines

Uracil = 2,4-dioxy pyrimidine

Thymine = 2,4-dioxy-5-methyl pyrimidine

Cytosine = 2-oxy-4-amino pyrimidine

Orotic acid = 2,4-dioxy-6-carboxy pyrimidine

Polynucleotides

Nucleotides are joined together by 3'-5' phosphodiester bonds to form polynucleotides. Polymerization of ribonucleotides will produce an RNA while polymerization of deoxyribonucleotides leads to DNA.

https://library.med.utah.edu/NetBiochem/pupyr/pupy15.gif

Explanation:

5 0

2 years ago