1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
barxatty [35]
2 years ago
15

9)

Biology
1 answer:
Sergeu [11.5K]2 years ago
4 0

Answer:

The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not.                               So i would think that it is A

Explanation:

Hope this helps!

You might be interested in
What a culture considers acceptable strongly influences the expression of anger. Which culture-bound syndrome is a dissociative
tekilochka [14]

Answer:

Amok.

Explanation:

Amok may be defined as a type of the culture bound syndrome and may occur due to the feeling of jealousy by an individual. Amok can be brought by the humiliation and desperation feeling.

The main characteristics of amok is aggression, brooding period outburst by violent and homicidal behavior towards people and object. The individual can do murder as well.

Thus, the answer is amok.

5 0
3 years ago
Where are the ribosomes found?
Sati [7]

Answer:

In eukaryotes, ribosomes can commonly be found in the cytosol of a cell, the endoplasmic reticulum or mRNA, as well as the matrix of the mitochondria. Proteins synthesized in each of these locations serve a different role in the cell. In prokaryotes, ribosomes can be found in the cytosol as well.

Explanation:

8 0
3 years ago
In an experiment, wich variable changes in response to the manipulation of another variable
vodomira [7]
Dependent variable changes 

7 0
3 years ago
The United States
valentinak56 [21]

Answer:

won the space race because they sent the first person to the moon

Explanation:

2nd one is false (Russia launched Sputnik)

4th is also false (Germany never participated in the Space Race)

3 0
3 years ago
Two veterinary technicians are learning about restraining a ferret. Technician A says when scruffing a ferret, its feet should b
alexandr1967 [171]
From what i know, the feet of an animal should always be on the table. This is due to the fact that aside from health reason's, the animal usually feels more comfortable not on it's back. 
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is this?
    13·1 answer
  • Which of the following represents the correct order of the processes responsible for the formation of sedimentary rocks? cementa
    7·1 answer
  • Why do you suppose the intestine is so long compared to the rest of the digestive tract?
    6·1 answer
  • Which of the following precautions should be taken to reduce the risk of chromosome mutations
    8·2 answers
  • Which of the following statements regarding pesticides is FALSE? a. Pesticides are found in food at levels that are below their
    15·1 answer
  • 5. What is the basic structure of a Silicate-Oxygen tetrahedron mineral
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What does the prefix top mean
    12·1 answer
  • Which contributes to the lack of evidence of the Period of Heavy Bombardment on Earth?
    15·1 answer
  • For the following DNA segment, please make the RNA segment that matches it.<br> ATT CGA AAG
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!