1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgesh-ka [11]
3 years ago
11

3. Some organisms have traits that help

Biology
1 answer:
Kipish [7]3 years ago
8 0

well they havent found the right guy for them so they aren't doing the nasty

You might be interested in
Zachary's student loans are an example of what type of loan? secured loan unsecured loan mortgage loan auto loan
MA_775_DIABLO [31]

The right option is; unsecured loan

Zachary's student loans are an example of unsecured loan.

An unsecured loan is a type of loan that is given and supported only by the borrower’s reliability without being protected by any collateral. If an individual is unable to pay the loan, the lender cannot take his or her property. Types of unsecured loan include student loans, credit cards and personal loans.


7 0
3 years ago
Read 2 more answers
What information is given in the MSDS for acetic acid? the mass of acetic acid that is consumed in an experiment the volume of a
marissa [1.9K]

Answer:

The reactivity of acetic acid with various chemicals.

8 0
2 years ago
Read 2 more answers
How can scientists determine the relative age of the fossil?
Strike441 [17]

Answer:

Radiometric dating methods

Explanation:

Geologists usually use radiometric dating methods, based on the natural radioactive decay of certain elements such as potassium and carbon to find the age of fossils.

7 0
2 years ago
A group of students form a Healthy Earth club at their school. Their goal is to limit their school’s impact on human-led climate
Sati [7]

Answer:

Explanation:

Think about what a school would have/use that has the most environmental impacts. I think of energy and waste from trash. To counteract these they could install a cleaner method of getting energy like solar panels and for the trash they could implement a recycling program

3 0
2 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Which of the following apply to food webs? Select all that apply
    6·1 answer
  • Which of the species you germinated was a monocot? Which on was a dicot
    11·1 answer
  • The term used to describe a harmless organism resembling a harmful one is _____. view available hint(s) the term used to describ
    10·1 answer
  • PLEASE ANSWER ASAP EMERGENCY PLEASE!!!! I WILL MARK BRAINLIEST!!!
    11·1 answer
  • How could stem cells prove helpful in the treatment of cardiovascular diseases? A) Stem cells can differentiate to form heart mu
    15·1 answer
  • General (common) name of your plant/animal and taxonomic species name of your plant/animal
    14·1 answer
  • Which Natural Step System Goal is being broken here?
    7·1 answer
  • If one plant is named Salvia greggii and another is named Salvia vanhouttei, what does this tell you about these plants?
    15·2 answers
  • An introvert prefers to:
    7·2 answers
  • How do the herbivores in a savanna habitat avoid competition?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!