1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
True [87]
2 years ago
15

What cell structure causes the shape of chloroplasts to be round?

Biology
1 answer:
morpeh [17]2 years ago
4 0

Answer: A plant cell has a cell wall, a central vacuole, and phosphids or chloroplasts. The cell wall provides structural support and protection.

You might be interested in
What process recharges our groundwater.
Alja [10]
Groundwater is recharged naturally by rain and snow melt , hope this helps :)
5 0
2 years ago
Which statement best describes the relationship between an allele's frequency and its dominance? A) Frequency and dominance are
marshall27 [118]

Answer:

D) Frequency results from environmental stresses, not dominance.

Explanation:

The allele frequency refers to the amount of frequency of a particular allele in a small population whereas the dominance and recessive are the measure of the effects of the allele on the population which decides the trait of an organism.

The frequency and dominance cannot be correlated with each other as the frequency of the allele in a population is the result of the environmental stress which are random and by chances, whereas the effect of dominance is not random but is the result of the favoured trait for survival.

Thus, Option-D is correct.

6 0
3 years ago
Which best describes the cell theory
Neko [114]
Each cell is alive even if it is part of a multi celled body, and all living organisms consist of one or more cells. Also, cells reproduce by dividing so it follows that all existing cells must have arisen by division of other cells. As a cell divides it passes it hereditary material- its DNA- to offspring.
8 0
3 years ago
Which best describes the molecule in the diagram below
Volgvan
Do u have the diagram ?????
6 0
3 years ago
On your Spring Break in Mexico, you take a break to count the starfish in a tidal pool. You notice that there is a rare recessiv
lana [24]

Answer:

0.04 for 6 legs starfish and 0.96 for 5 legs starfish.

Explanation:

The allele frequency for the 6 legs starfish is 0.04 whereas, the allele frequency for the 5 legs starfish is 0.96 because there is only one 6 legs starfish in the given population as compared to 5 legs starfish. The low population of 6 legs starfish is due to the presence of recessive allele while on the other hand, higher population of 5 legs starfish is due to the presence of dominant allele. The allele frequencies for both population is done by dividing the allele of interest by total number of alleles present in the population.

5 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The metaphyses of a 40-year-old's long bones have?
    10·1 answer
  • The salivation of dogs in pavlov’s experiments was significant because it ____.
    13·2 answers
  • A series of deep muscular relaxation techniques combined with visualization is characteristic of:
    13·1 answer
  • What percentage of glomerular filtrate becomes urine?
    6·1 answer
  • Which enzyme(s) require(s) the addition of HCl for optimum activity?
    12·1 answer
  • The w-4 form is completed by an individual when he or she first starts a new job. what does this form help to determine? brainly
    14·2 answers
  • Write the complimentary strand of DNA A C G T C C G A
    5·2 answers
  • Someone help pleasesdesereffgfqsgdafge
    9·2 answers
  • 1. Draw a lake and label the photic, aphotic, littoral, limnetic, and benthic zones.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!