1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
3 years ago
11

What are the current problems with pesticides application methods?

Biology
1 answer:
Sati [7]3 years ago
6 0
One problem with pesticide application is that if they use spray, it leaves a residue, so if a child or animal were to get in contact with the pesticide and accidentally ingest it, it could injure them. 
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
In which phase do sister chromatids line up in the middle of the cell, (in 'single-file', without a homologous partner)? Group o
ipn [44]

Answer:

The correct answer is ''METAPHASE I.''      

Explanation:

Metaphase I is the stage in which chromosomal studies are generally performed, because its morphology is very clear. The chromosomes, moved by the mitotic spindle, are placed in the center, between the two asters and form the so-called metaphase plate, in which the chromosomes are positioned in such a way that the kinetochore of each sister chromatid are oriented towards the opposite poles. Keeping chromosomes on the cell equator implies a balance between the forces of the microtubules that tend to move the kinetochores toward opposite poles, so positioning them in the center involves a great deal of energy.In each kinetochore, between 20-30 microtubules can be anchored, which exert traction force towards the pole from which they come, so the metaphase plate is maintained by the balance between the opposite forces of the poles on the chromosomes, which hold their sister chromatids by centromeric cohesin.

3 0
2 years ago
What is the Lining of the heart?
Alchen [17]
The lining of the heart is the pericardium.
8 0
3 years ago
Read 2 more answers
Is it true that all the cells in your body are eukaryotic?
Ratling [72]
Yes very true because we are not bacteria
4 0
3 years ago
Read 2 more answers
Just fill out the Punnett squares using the key that's provided, and plz don't answer with links, actually help me.... either do
Lisa [10]

Answer:

Filled out punnett square is in the image

5 0
2 years ago
Other questions:
  • The total population graphs below display the results of two different five-year hunting cycles, one on light trees and one on d
    13·2 answers
  • Temporal isolation vs geographical isolation
    5·2 answers
  • Whats worse than stepping on your pet accidentally?
    7·1 answer
  • When a cell is part of an active formula, it is surrounded with ________?
    15·1 answer
  • Answer this question
    14·1 answer
  • Which condition is inherited as a dominant allele?
    5·2 answers
  • Which best explains why water is able to “stick” to the side of glass? Strong adhesive forces exist between different water mole
    10·1 answer
  • What specific type of symmetry does a sea star have?
    6·2 answers
  • Explain why you think that in biology we often discuss things in terms of population instead of individual organisms.
    5·1 answer
  • Do plants complete cellular respiration like humans to create energy?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!