1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
3 years ago
11

What are the current problems with pesticides application methods?

Biology
1 answer:
Sati [7]3 years ago
6 0
One problem with pesticide application is that if they use spray, it leaves a residue, so if a child or animal were to get in contact with the pesticide and accidentally ingest it, it could injure them. 
You might be interested in
Vinegar is a(n) ________ because its pH is about 3.5.
kari74 [83]

Vinegar is an Acid because its pH is about 3.5

4 0
2 years ago
Read 2 more answers
Natural selection is a process by which organisms remain the same overtime to maintain consistency. True or False
lisabon 2012 [21]
Falso porque natural selection is actually the process where organisms that are better adapted to their environment tend to produce more offspring than those that have a disadvantage
5 0
2 years ago
Read 2 more answers
Why did alfred hershey and martha chase chose to use bacteriophages in their research?
frozen [14]
C.c is the correct answer
6 0
3 years ago
2. provides energy to a cell
pishuonlain [190]

Answer: Mitochondria

Explanation: The mitochondria make energy within the cell

6 0
3 years ago
The human infant spends about half of its sleep time in rem. What is the understanding of why this is the case?
Molodets [167]

This occurs because REM sleep may provide at least part of the stimulation necessary to correctly develope the immature brain of infants.

REM sleep provides the electrical activity necessary to establish neural connections that include the  development of synapses in the brain. These neurological process enables development of sensory, motor, learning and memory system.


4 0
3 years ago
Other questions:
  • If a star fish loses an arm it can__________itself, the arms work__________of each other.
    14·2 answers
  • How many milliliters of a 2 M solution would contain 1 mole of sucrose?
    10·1 answer
  • In this exercise, you will identify when various events occur during the cell cycle. recall that interphase consists of the g1,
    13·1 answer
  • What term refers to the possession of both masculine and feminine gender characteristics?
    9·1 answer
  • Arrange the tiles to show the sequence of events in the development of the theory of evolution.
    13·1 answer
  • Even the wettest desert gets how much inches of perception
    14·1 answer
  • Water is an example of a(n) _____.
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Help ueu<br> Sf dg dgnegndgndgndg sfns efngensgnsg eyney.eymn
    6·2 answers
  • Plan a good post-workout meal with both carbs to replace _________________ stores and protein for muscle ______________ and repa
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!