1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ser-zykov [4K]
3 years ago
15

This type of system does not interact with the environment around it. It recycles all of the mass on its own.

Biology
1 answer:
deff fn [24]3 years ago
6 0

Answer:

C. Isolated system

Explanation:

The question above is related to the the topic, "Thermodynamics."

Thermodynamics refers to how energy is being transferred among molecules. This study focuses on the "system" and the "surroundings/environment"

There are actually<u> three types of systems</u><em> (open, closed and isolated).</em> When it comes to "isolated system," such system doesn't interact with the surroundings. This means that, i<u>t is incapable of exchanging energy or matter with its environment.</u> This means that neither mass nor energy will be able to enter it; thus, it recycles all of the mass on its own.

You might be interested in
What are two reactants needed for cellular respiration?
ddd [48]
Oxygen and glucose are need for cellular respiration
4 0
4 years ago
Read 2 more answers
BRAINLIEST ASAP+ 10 POINTS
svp [43]

1.) is C. ATP

2.) is A. two  pyruvate molecules

3.) is B. NADH and FADH2

4.) is A. an anaerobic process that has CO² as a byproduct

5.) is b.  lactic acid fermentation

5 0
4 years ago
Since the mid-1980s, the population of California condors has
DochEvi [55]

Answer:

i has been increasing steadily

Explanation:

5 0
3 years ago
During photosynthesis, plants capture light energy and form carbon-containing molecules, such as glucose. Which is not a use for
nlexa [21]

Answer:

During photosynthesis, plants capture light energy from the Sun to break weak bonds in reactants, such as carbon dioxide and water, and form carbon containing molecules, such as glucose. The carbon containing molecules can then be used:

✓ to assemble larger molecules, such as DNA, proteins, and fats.

Explanation:

5 0
3 years ago
Los elefantes marinos del norte tienen poca variabilidad genética, probablemente, por un proceso que le hicieron pasar los hombr
Darina [25.2K]

Answer:

elefantes marinos mmmmmmmmmm

7 0
3 years ago
Other questions:
  • In what way(s) are mycelia and fruiting bodies similar?
    8·1 answer
  • Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?
    5·1 answer
  • What is a cold front in weathering
    6·2 answers
  • Which is NOT a way carbon gets released into the ocean?
    15·2 answers
  • A client is admitted for treatment of glomerulonephritis. on initial assessment, the nurse detects one of the classic signs of a
    5·1 answer
  • In anaphase, sister chromatids separate and become full-fledged chromosomes that move to opposite poles.In anaphase, sister chro
    10·1 answer
  • What is the purpose of the fruit the develops on a flower?
    13·1 answer
  • Which list of words includes three principles of training? *
    10·1 answer
  • Interaction: lungs supply oxygen carried by blood to cells of the body
    5·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!