1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
2 years ago
15

A DNA strand has the sequence ACCGAGCTT which is the complementary strand of RNA

Biology
2 answers:
egoroff_w [7]2 years ago
7 0
UGGCUCGAA I believe m8
iris [78.8K]2 years ago
5 0
I believe it is this.
TGGCTCGAA

because they must be opposite of their pairs
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
At what phase does crossover occur in
vesna_86 [32]

Answer: crossing over happens in prophase 1.

Explanation: ( in Portuguese ) os cromossomas homólogos, na profase 1 da meiose, tocam-se, trocando informações sobre o ADN. A esse processo chama se crossing over.

8 0
3 years ago
Read 2 more answers
Which geological process directly forms beaches on the shore of a bay?
Andrew [12]

Answer:

erosion, transportation, and deposition.

Explanation:

i took the topic and i remembered. please like and rate my answer. brainleast please?

3 0
3 years ago
Why is water able to dissolve a wide variety of solutes?
kondor19780726 [428]

It is a polar molecule I'm pretty sure. And hinataaaa

5 0
3 years ago
The result of a magma plume rising and decompression melting occurring may
suter [353]
Hot spot: is the answer
4 0
3 years ago
Other questions:
  • Enzyme which seals dna fragments together
    8·1 answer
  • To reproduce, female elephants produce eggs and male elephants produce sperm. Offspring are produced by the fusion of an egg wit
    10·2 answers
  • Jenny would like to bring her service animal to work, a Labrador Retriever who helps her deal with severe anxiety. She is not su
    13·1 answer
  • Help me on problem 14 b please
    10·1 answer
  • Please answer this question
    7·1 answer
  • Salinas makes cell walls rigid which indicates that
    9·1 answer
  • Organisms ______ to changes in their surroundings.
    12·2 answers
  • The events in the ovarian and uterine cycles are largely controlled by the pituitary gonadotropins and ovarian hormones. Before
    5·1 answer
  • The nurse recognizes that the patient who is taking an adrenergic-blocking drug understands the importance of avoiding other sub
    13·1 answer
  • What type of concern is raised by embryonic stem cell research?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!