1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trapecia [35]
4 years ago
9

Are there striations across the width of muscle cells?

Biology
1 answer:
Lady bird [3.3K]4 years ago
3 0
Here is your answer I hope it was useful: a striation is any of a number of tiny parallel grooves such as: the scratches left by a glacier on rocks or the streaks or ridges in muscle tissue. Your answer is yes, there are striation across the width of a muscle.
Have a nice day.

You might be interested in
Which of the following does not happen when a cell divides?
mars1129 [50]
D. it does not become more difficult for the cell to get enough oxygen and nutrients. 
8 0
3 years ago
Which number belongs in the space labeled X?<br><br> A) 5<br> B) 7<br> C) 8<br> D) 10
Andrew [12]
The answer to this question is A)5
5 0
3 years ago
In what way could the realized niche be regarded as flexible
Roman55 [17]

Answer: Because it can change size based on the needs.

Explanation:

<u>The term niche defines an organism´s role in an ecosystem </u>and it also encompass what the organism eat or how it interacts with nonliving elements of the environent.

The realized niche could be regarded as flexible because it is able to change its size based on what it needs. For example, it could increases or decreases its size in competition between resources with other species since they are part of the same ecosystem.

4 0
3 years ago
When plants grow towards sunlight, they __________.
tekilochka [14]

generate energy by photosynthesis

5 0
4 years ago
Read 2 more answers
What forms white light?
Soloha48 [4]
<span>The right option is <span>B) Combination of all the wavelengths of visible light
</span><span>White light is formed when there is mixture of all the colors of the visible light spectrum (ROYGBIV). White light is perceived when all the wavelengths of the visible light spectrum strike the eye at the same time. The sensation of white is not the result of a single color of light. 
</span></span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement best explains how a cyclone forms?
    9·1 answer
  • Which type of selection tends to increase genetic variation? view available hint(s) which type of selection tends to increase ge
    5·2 answers
  • Identify the type of symmetry displayed for each item. then, indicate how you came to your conclusion:
    13·1 answer
  • Amniotes are divided into three groups based in their skull morphologies. what are these three groups, and how do their skulls d
    7·1 answer
  • How do I know when eclipses occur....please help me
    13·2 answers
  • At what angle relative to the velocity of a red blood cell should the transducer be held during Doppler ultrasound to most accur
    8·1 answer
  • The manufacturer of the chocolate mint cookies changed the ingredients of its cookies. Each serving now has 1 gram of saturated
    14·1 answer
  • Why are most systems in Why are most systems in the human body negative feedback systems? Negative feedback systems balance the
    14·1 answer
  • Indicate whether each of the following mutations would likely promote or inhibit apoptosis in cells harboring the mutation(s). E
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!