1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
True [87]
3 years ago
11

What are viroids?

Biology
1 answer:
GaryK [48]3 years ago
6 0
The answer is "short strands of circular RNA"
You might be interested in
Explain why biomes are not tyically classified by temperture
12345 [234]

Answer:

Explanation:

Biomes are typically not classified by temperature, because some biomes can experience extreme temperatures from one season to the next. Other biomes might have a more consistent temperature throughout the year.

5 0
3 years ago
Read 2 more answers
During _____________, the cell uses information from messenger RNA to produce proteins. A) respiration B) translation C) transcr
Karo-lina-s [1.5K]

Answer:

B)translation

7 0
3 years ago
Increase the mutation rate with radiation or chemicals.
MakcuM [25]

Answer:

Use chemicals to prevent chromosomal separation during meiosis in plants.

8 0
3 years ago
Read 2 more answers
What beak shape do you think will be best for finding food in a period of abundant rainfall?
irina [24]

Answer:

Shorter beaks will be best for finding food in abundant rainfall.

3 0
2 years ago
Savanna’s do not exist in the United States because
vesna_86 [32]
There are no true tropic climates
6 0
3 years ago
Other questions:
  • Plankton are most commonly found in the
    12·1 answer
  • Describes an organism that can exist only as a group of cells
    11·2 answers
  • What are the wavelike muscle contractions that help move food along the digestive tract?
    12·2 answers
  • Why is field flooding used More Often by Farmers than drip or sprinkler irrigation
    11·1 answer
  • About one hundred thousand years ago, very fluid lava started erupting slowly and gently from a place near a plate boundary. Wha
    8·1 answer
  • What are the 3 parts of the dna nucleotide?
    13·1 answer
  • Which of the following is not a characteristic of organisms that make up
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which term means "physical traits"?​
    8·2 answers
  • Source 1: Requiring school districts to recycle will reduce the emissions of greenhouses gases that damage the environment. Scho
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!