The iodine can change the color of the starch to a deep blue to black color.
Biodiversity is essential in medicine as most active chemicals used to make medicines are derived from plants or other organisms. Climate change today threatens species that are vital to medicine. An example would be coral reefs. Studies have been done on reefs that look at fighting cancers, HIV and other ailments. One of the richest zones of biodiversity is the tropics and this region is under threat from global warming and deforestation. It is important to preserve these species for use in future medicinal research. <span />
Answer:
Chargaff's rules state that DNA from any species of any organism should have a 1:1 stoichiometric ratio (base pair rule) of pyrimidine and purine bases and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
The best method that help to prevent wind erosion is decreasing riverbank slopes. The correct option is A.
<h3>What is wind erosion?</h3>
Wind erosion is the erosion of the top layer of the soil by wind. Top layer contain nutrients of the soil, is it eroded the soil become of fewer nutrients and quality.
Thus, the correct option is A. decreasing riverbank slopes.
Learn more about wind erosion
brainly.com/question/15081536
#SPJ1
