1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PIT_PIT [208]
3 years ago
10

Which of these would NOT lead to conservation and protection of the fresh water on earth?

Biology
1 answer:
IrinaK [193]3 years ago
8 0

Promotion of increased activities such as voting and jet ski

You might be interested in
What element does your model represent?
AfilCa [17]

Answer:

I guess photosythesis

Explanation:

6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What kind of molecule carries the alleles from parent to offspring
zheka24 [161]

Answer:

DNA

Explanation:

The Roles of DNA, Genes, Alleles, and Chromosomes in Inheritance. Explain that the information passed from parents to offspring is transmitted by means of genes which are coded in DNA molecules. Explain the basic process of DNA replication.

6 0
4 years ago
Read 2 more answers
The body can be invaded by pathogens , which are harmful microorganisms that cause infection diseases. The body then initiates a
pochemuha

Answer:The term "disease" refers to conditions that impair normal tissue function. For example, cystic fibrosis, atherosclerosis, and measles are all considered diseases. However, there are fundamentally different causes for each of these diseases. Cystic fibrosis (CF) is due to a specific genotype that results in impaired transport of chloride ions across cell membranes, leading to the production of abnormally thick mucus. Thus, CF is most accurately called a genetic or metabolic disease. Atherosclerosis, which can lead to heart attacks and strokes, may be considered a disease of aging, because it typically becomes a problem later in life after plaques of cholesterol have built up and partially blocked arteries. In contrast, measles is an infectious disease because it occurs when an individual contracts an outside agent, the measles virus. An infectious disease is a disease that is caused by the invasion of a host by agents whose activities harm the host's tissues (that is, they cause disease) and can be transmitted to other individuals (that is, they are infectious).

8 0
3 years ago
Animals have two major types: _____.
Pachacha [2.7K]
B. vertebrates and invertebrates. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • Heterozygous Cp cp chickens express a condition called creeper, in which the leg and wing bones are shorter than normal (cp cp).
    13·1 answer
  • Mitosis and binary fission are both forms of cell division that produce identical, or close to identical, daughter cells. What i
    7·2 answers
  • In Table 9-1, explain the way that ammonia, salt, and water are alike.
    11·1 answer
  • What structure stores and concentrates bile to aid in the digestion of fats?
    8·1 answer
  • Which of the following statements is true? The Milky Way Galaxy is the only galaxy in the universe. The earth is always the same
    13·1 answer
  • Daniel is playing on the swings at the playground. At the top of his swing, he will have _____. no potential energy and all kine
    14·2 answers
  • Describe the treatment goals for dialysis.
    6·2 answers
  • Which statement best describes how some trees respond to decreasing
    9·2 answers
  • Plz help ill give brainliest
    9·2 answers
  • Which of the following is an example of a mechanical wave?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!