1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
3 years ago
9

Which sequence is the correct order to make a peanut butter & jelly sandwich?

Geography
1 answer:
Lilit [14]3 years ago
4 0
Peanut butter on one slice then jelly on the other slice of bread then put them together
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which city is farthest from the epicenter of an earthquake?
Anastaziya [24]

Answer:

chicago

Explanation:

5 0
3 years ago
Read 2 more answers
Why are annual temperature ranges in the Southern Hemisphere generally smaller than those in the Northern Hemisphere? A. There i
Sonja [21]

Answer:

It's A

Explanation:

Because of this reason, That's why Southern Hemisphere have milder climate

Hope this helps

3 0
3 years ago
Where is Hawaii located ​
Zielflug [23.3K]
it’s located in the united state’s
6 0
3 years ago
Which European country has not had a strong cultural influence on Luxembourg A. belgium b. france. c. the netherlands d. germany
Romashka-Z-Leto [24]
The answer is the netherlands
6 0
4 years ago
Read 2 more answers
Other questions:
  • ____ occurred when financiers bought up several producers of the same product, giving the new owners a large share of the total
    10·1 answer
  • The map shows the surface temperature of the Gulf Stream and the ocean water farther north. Where are deep currents most likely
    12·1 answer
  • According to President Roosevelt, does the United States intend to take over any lands in the Western Hemisphere? Cite textual e
    11·1 answer
  • If you found a line of volcanic peaks a few hundred miles long in which the volcanoes were progressively older toward one end of
    6·2 answers
  • What are nonexamples of a rock cycle​
    8·2 answers
  • I need a list of animals and plants that live in alasks
    7·1 answer
  • ASAP Need Help Thankyou​
    9·1 answer
  • A geographer is interested in conducting an analysis of possible spatial associations. Which of the following geospatial technol
    6·1 answer
  • What are this word is ❓❓​
    7·2 answers
  • What is the best explanation for why tropical regions normally receive more precipitation than other areas of the globe
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!