All categories

3 years ago

1. A hypothesis and a theory are related because

Biology

2 answers:

Evgen [1.6K]3 years ago

4 0

<h2>Answer to Q1: </h2>

C. the data collected when a hypothesis is tested can support a theory.

<h2>Explanation: </h2>

In scientific method theory and hypothesis are two major components. A hypothesis is either a suggestion for an observable phenomenon, or a prediction of a possible relation among different phenomena. Whereas a theory is a tested, well-substantiated, unifying explanation for a set of verified, proven factors. So we can say that the data collected when a hypothesis is tested can support a theory.

<h2>Answer to Q2 </h2>

B. released

<h2>Explanation: </h2>

The word Exo means out or released therefore exorgonic reactions are those reactions in which energy is released. The same reaction which allows energy release is called exothermic reaction and the energy is in the form of heat.

<h2>Answer to Q3. </h2>

A. carbon dioxide + water ->glucose + oxygen

<h2>Explanation: </h2>

Photosynethesis is the process in which plants make their food in the presence of sunlight. A simple word equation that can be used to describe the process of photosynthesis is carbon dioxide + water —> glucose + oxygen + water. A balanced chemical equation for the process can be written as 6CO2 + 6H2O —> C6H12O6 + 6O2. Overall, photosynthesis uses light energy to convert carbon dioxide into a carbohydrate.

<h2>Answer to Q4. </h2>

B. the activation energy of the reaction

<h2>Explanation: </h2>

Enzymes are just like catalysts in an y chemical reaction. We know that catalysts are the chemicals which speeds up the reactions. In the same way enzyme speeds up the reaction and they increase the activation energy of any chemical reaction.

kozerog [31]3 years ago

3 0

1=C
2=B
3=B
4=B
Hope this helps. (I'm not 100% sure on #3)

You might be interested in

Can some one code this dna

cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand

TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand

GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand

GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand

AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0

3 years ago

Why do sex-linked traits follow different patterns of inheritance than other traits ?

Inga [223]

Answer:

because

Explanation:

its in the parents gene pool

4 0

3 years ago

True or False: If one thing in a food web is affected, it will only probably affect the organism that directly relies on it for

joja [24]

Answer:

False

Explanation:

Due to the fact that all the organisms are connected in a chain, the energy flow would be affected and that would result in many organisms being deprived of energy they need and that creates a chain effect.

7 0

3 years ago

A woman who is a carrier for colour blindness (X-linked recessive) has children with a man who has normal colour vision. A. What

viva [34]

Answer:

Explanation:

The Genotype of the woman is XCbXN

The man XNY

Since the allele for the color blindness is carried on one of the X -chromosomes of the carrier mother, then the male children will be color blind or carrier deopending on the defective gene they inherited. Since they will receive the defective or normal allele from the mothers,but the female will carriers or normal because they will inherit either defective allele or normal allele from the mother,but normal X allele from the father.

Assuming the colorbind gene was inherited by One of the boys, and the girls take the defective genes

1. XNY vs XCbXN.Then the one of the boys will be colorblind and the one of girls will be carriers. XNXCb, XNXN, XCbY,XNY 50 %

2.If the two boys take the effective genes from the mothers. and none of the girls take the defective alelle

Then the two boys will be colorblind and the girls will be carrries XcbY,XcbY and XNXN XNXN.(normal girls).

The proportions that will be the females since the girls can only take the defective allele from one of the normal and defective allele from the mother. Assuming the girls take the defective allele from the mothers and take normal from the father,they will all be carriers,since the X of the father is normal.

They can not have a color blind girl.Since the father is normal It takes two colorblind X-chromosome to give a girl.

5 0

3 years ago

in which process does the water form clouds. A-transpiration B-condensation C-evaporation D-percolation

Andrew [12]

B--Condensation. <span>Condensation </span>is<span> responsible for the formation of </span><span>clouds,</span>

7 0

3 years ago