1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ede4ka [16]
2 years ago
11

24. Rising motion due to vorticity and warm air advection are most commonly found to the ____________ of the 500 millibar trough

axis over the United States. a. Left b. Right c. North
Biology
2 answers:
yarga [219]2 years ago
4 0

B. Right

Hope that helps :) ❤️

Gelneren [198K]2 years ago
3 0

B.) Right

Hope it helps

You might be interested in
Why postharvest physiology is important to maintain sustainable food supply on this planet. Please give named examples and discu
Setler79 [48]

Answer:

Postharvest physiology plays a fundamental role in extending the shelf-life and quality of plant products. An example of postharvest physiology methodologies is by reducing the temperature to improve shelf-life before consumption

Explanation:

Postharvest physiology refers to the methodologies used for extending shelf-life and quality, thus being a critical issue in food systems. Postharvest approaches include chemical treatments, temperature reduction, cleaning and disinfection methods, etc. Crop varieties are genetically selected in order to maintain nutritional qualities of stored seeds for a long time after harvest. These seeds are also controlled during storage by using postharvest handling practices (e.g., chemical and enzyme inhibitors that extend shelf life).

5 0
2 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which of the following is the simplest unit of nucleic acid
g100num [7]
Nucleotide!

When attached in a polymer, they become a nucleic acid.
6 0
2 years ago
When two experiments are identical except for one variable, the experiment is called a(n) _____.
zzz [600]
Controlled experiment
8 0
3 years ago
unattached earlobes is a dominant trait e . a parent who is homozygous for unattached earlobes y crossed with a parent who is ho
marishachu [46]
The genotypic ratio of their offspring is 100% Ee.

Hope this helps! God bless
-vf
3 0
3 years ago
Other questions:
  • After digestion is completed what goes into the blood streem
    14·1 answer
  • In a cohort study, a scientist collects health data on a group of people born in 1976. What characteristic was used to form the
    9·2 answers
  • The water content of a typical human cell is around 65 - 70%. Using your knowledge of cellular anatomy and physiology, what is t
    15·1 answer
  • Bipedalism's advantages over quadrupedalism include
    13·1 answer
  • Select the description of mRNA. a.a three‑dimensional complex of ribonucleotides and proteins that assembles polypeptide chains
    12·1 answer
  • Atoms in covalent bonds___their electrons​
    6·1 answer
  • Which describes a protein? A. Forms an important part of cell membranes. B. Provides the greatest amount of energy per gram. C.
    13·1 answer
  • CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST THANK YOU
    14·1 answer
  • What is photosynthesis?Explain.​
    7·2 answers
  • Q.21.What are the functions of nucleus . In cell .​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!