1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Licemer1 [7]
3 years ago
8

Organisms that use bulk flow to move oxygen are able to:

Biology
1 answer:
Pavel [41]3 years ago
7 0
<span>B. achieve larger size than organisms that only use diffusion.</span>
You might be interested in
How do Arrow poison trees disperse their seeds? Explain your answer.
natita [175]

Answer: Acokanthera schimperi (Arrow Poison Tree) is a species of tree in the family Apocynaceae. It has a self-supporting growth form. It has simple, broad leaves. Arrow Poison Tree is a photoautotroph.

Explanation: The bark, wood and roots of Acokanthera schimperi are used as an important ingredient of arrow poison in Africa. All plant parts contain acovenoside A and ouabaïne, which are cardiotonic glycosides. Its fruit is edible, and is eaten as a famine food. When ripe they are sweet but also slightly bitter. Unripe fruits have caused accidental poisoning as they are highly toxic.[3]

The maned rat spreads the plant's poison on its fur and becomes poisonous.[4]

It is also used in traditional African medicine.[5] In Ethiopia, for example, Acokanthera schimperi leaves have been traditionally used for jaundice.

There seeds are dispersed by,

Other methods of dispersal

Some plants don’t invest much energy in complex mechanisms for dispersal. Bluebells or wild hyacinths (Hyacinthoides non-scripta) are one example of a plant that simply drops its seeds directly to the ground. However, the result is that such plants will tend to spread and colonise new areas very slowly indeed.

 

 

4 0
3 years ago
Somebody help me so I can give y’all some points
pashok25 [27]

Answer:

b

Explanation:

cbjfgjyjyjyj j5thtjtjyjyjgjyk

6 0
2 years ago
Read 2 more answers
What does osmosis and diffusion have in common
Sladkaya [172]
They’re both passive processes meaning they don’t need energy to occur, both are spontaneous processes
8 0
3 years ago
Read 2 more answers
Unlike the methods of early scientists, how did Sir Francis Bacon believe basic laws of science should be determined?
butalik [34]
<span>Unlike the methods of early scientists, Sir Francis Bacon believed basic laws of science should be determined by using inductive reasoning based on empirical evidence. You cannot formulate a law in science if you don't have evidence to support it - so you cannot just take a basic truth and formulate your law based on that - there has to be some kind of evidence to prove your theories. Also, based on those evidence, you will induce a conclusion necessary for such laws, which is something Bacon understood, unlike early scientists.</span>
3 0
3 years ago
Read 2 more answers
We will now consider the secretions involved in fat digestion, including the organs that secrete or release them. review the lis
zhenek [66]
I cannot find the list of molecules and organs, but I gonna explain all existing lipid digestion.
First, you should know that triglycerides are not absorbable. The absorbable substances are free fatty acids, monoglycerides and cholesterol.

The main stages of lipid digestion:-Fat emulsification;
-Hydrolysis of lipids (by enzymes);
-Formation of micelles;
-Endocytosis of the micellar contents.

The enzymes responsible for lipid hydrolysis are:
lipases (pancreatic): secreted by the exocrine pancreas
colipase: secreted by the pancreas in an inactive form. Its role is to help the lipase in its activity.
cholesterol esterase: secreted by the pancreas too.
phospholipase A2: exists in the majority of the cells
4 0
3 years ago
Other questions:
  • When dna replication halts in a polymerase chain reaction, owing to the incorporation of a tagged base into a growing dna chain,
    9·1 answer
  • What are the two main types of energy?
    11·2 answers
  • What is chragaff rule on DNA pairing
    10·1 answer
  • The gas nitric oxide has been identified as a signaling molecule. Which of the following mechanisms of action would you expect f
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • NEEDED NOW PLZ!!!
    12·1 answer
  • What term defines a gene made up of two different alleles
    6·2 answers
  • A plant tropism involves the responses. This response is always the result of—
    11·1 answer
  • Which of the following is an example of carbon being moved from the biosphere to the lithosphere?
    12·1 answer
  • Need help with the following !
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!