1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixas84 [53]
3 years ago
11

The response of an effector is _____.

Biology
1 answer:
Troyanec [42]3 years ago
5 0

Answer:

To maintain homeostasis

Explanation:

Effectors are organs, cells or tissues that provides the required output after receiving a feedback from the control center. Nerve impulse instructs the effector to bring things into balance and required range. They then influence the magnitude of stimulus and maintain homeostasis.

You might be interested in
On the ventral surface of the brain, you can observe the optic nerves and chlasma, the pituitary gland, and the mammillary bodie
ivann1987 [24]

Answer:

Diencephalon.

Explanation:

Brainliest???

6 0
3 years ago
Read 2 more answers
hen faced with a sudden drop in environmental temperature, what will happen to an ectothermic animal? it is likely to experience
sergey [27]

Answer:in addition are formation of goose pimples and erection of hair muscles so as to trap more air thus insulation

6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What substance is needed to begin the process of glycolysis?
MrRissso [65]
Glucose or fructose. In glycolysis, glucose is oxidized to be pyruvate. 
7 0
2 years ago
Primary spermatocytes are diploid (2n) cells with all of the organelles typically found in eukaryotic animal cells. Spermatogene
Aneli [31]

Answer: a. Genetic recombination (crossing over)

b. Can also be explained in terms of crossing over

c. Non disjunction of homologous chromosomes in meiosis 1

Explanation:

The process that allows for the transfer of both the paternal and maternal materials to is the crossing over process that takes at meiosis 1 changing them to secondary spermatocytes. While they are still primary spermatocytes, they are still diploid cells having both the maternal and paternal chromosomes. But since the spermatozoon is an haploid cell, it is able to retail some of both parents chromosome by the crossing over event which takes place between homologous paternal and maternal chromosomes allowing them to exchange materials. Thus the chromosomal contents of the primary spermatocyte differs from that of the spermatozoon.

C. This can occur as a result of the one of the homologous chromosome pair refusing to separate at meiosis 1 with one gamete containing 4 chromosomes/8 sister chromatids and the second having 2 chromosomes/4 sister chromatids.

3 0
3 years ago
Other questions:
  • Which describes the two cells formed through mitosis?
    8·2 answers
  • Within a single use of the scientific method, which of the following steps can only be performed after data is collected? A. The
    5·2 answers
  • Quick help needed!
    5·1 answer
  • Compare the behavior of an endotherm and an ectotherm on a hot summer day. How does each organism respond to changes in the envi
    7·2 answers
  • You are an epidemiologist in charge of county health services for low income, HIV positive individuals in NJ. Which data would b
    12·1 answer
  • Would prescribing calcium salt helps to treat the primary bone problem in scurvy?​
    14·1 answer
  • Which of the following contain genetic code made of RNA as well as the reverse transcriptase enzyme?
    6·1 answer
  • The sugars of a DNA and RNA molecule are alternated with in the backbone of the strand
    8·1 answer
  • What does tim mean when he says bacteria are the most abundant form of life on earth?.
    14·1 answer
  • Which organism would be classified as a saprotroph?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!