1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alekssr [168]
3 years ago
9

The graph above shows the changes in temperature recorded for the 2.00 l of h2o surrounding a constant-volume container in which

a 1.00 g sample of benzoic acid was combusted. Assume that heat was not absorbed by the container or lost to the surroundings

Chemistry
1 answer:
Otrada [13]3 years ago
6 0

Answer:

25.2 kJ

Explanation:

The complete question is presented in the attached image to this answer.

Note that, the heat gained by the 2.00 L of water to raise its temperature from the initial value to its final value comes entirely from the combustion of the benzoic acid since there are no heat losses to the containing vessel or to the environment.

So, to obtained the heat released from the combustion of benzoic acid, we just calculate the heat required to raise the temperature of the water.

Q = mCΔT

To calculate the mass of water,

Density = (mass)/(volume)

Mass = Density × volume

Density = 1 g/mL

Volume = 2.00 L = 2000 mL

Mass = 1 × 2000 = 2000 g

C = specific heat capacity of water = 4.2 J/g.°C

ΔT = (final temperature) - (Initial temperature)

From the graph,

Final temperature of water = 25°C

Initial temperature of water = 22°C

ΔT = 25 - 22 = 3°C

Q = (2000×4.2×3) = 25,200 J = 25.2 kJ

Hope this Helps!!!

You might be interested in
What happens in the process of beta decay?
Andrej [43]

Answer:

A neutron transforms into a proton and an electron.

Explanation:

i took the test got an 100%

6 0
3 years ago
How many independent variables are allowed in an experiment
Dmitriy789 [7]

one independent variable

8 0
3 years ago
Read 2 more answers
Suppose you have made the following hypothesis:
Rudiy27
There are less sharks farther from coral reefs.
5 0
3 years ago
Read 2 more answers
PLZ HELP ASAP!!!
melomori [17]
Sandy soil because the sand will erode faster then the clay will causeing the well to cave in
6 0
3 years ago
You made hypochlorous acid (HOCI) by mixing bleach (NaOCI) with:
Annette [7]

<u>Answer:</u> When bleach is mixed with water, it produces hypochlorous acid.

<u>Explanation:</u>

The chemical name for bleach is sodium hypochlorite. When this compound is reacted with water, it produces hypochlorous acid and sodium hydroxide.

The chemical equation for the reaction of sodium hypochlorite and water follows:

NaOCl+H_2O\rightarrow HOCl+NaOH

By Stoichiometry of the reaction:

1 mole of sodium hypochlorite reacts with 1 mole of water to produce 1 mole of hypochlorous acid and 1 mole of sodium hydroxide.

Hence, when bleach is mixed with water, it produces hypochlorous acid.

6 0
3 years ago
Other questions:
  • The concentration of hydrogen in soil sample 13 * 10 ^ - 6 * M the soil is tested with a pH meter, what value should the meter r
    11·1 answer
  • Write a balanced nuclear equation for the beta decay of protactinium
    13·1 answer
  • a manufacturer claims its cleanser work twice as fast as any other . could testt be performed to support the claim?
    13·1 answer
  • Limestone is used to make cement and mortar. <br> a. True <br> b. False
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • PLEASE HELP ASAP
    7·1 answer
  • New cells are created from ...
    14·2 answers
  • Graph the pH function using the graphing utility. Then answer the questions. What is the pH of lemon juice that has a hydrogen i
    8·1 answer
  • ........................
    8·1 answer
  • How many carbon monoxide molecules are in 0.75 moles of carbon monoxide?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!